Description :
From Genome Similarity Track
Location :
Scaffold_340:24819- 41992
Transcript NameFunction/comments
Phyin_T30-4PITG_23204Ubiquitin-activating enzyme (E1)%2C putative
Phyin_T30-4PITG_232054-nitrophenylphosphatase%2C putative
Phyin_T30-4PITG_21595Putative uncharacterized protein
Phyin_T30-4PITG_21596Actin-related protein 2/3 complex subunit%2C putative
Phyin_T30-4PITG_21597Putative uncharacterized protein
Phyin_T30-4PITG_21598Putative uncharacterized protein
Phyin_T30-4PITG_21599Putative uncharacterized protein
Phyin_T30-4PITG_21600Putative uncharacterized protein
Phyin_T30-4PITG_21601Putative uncharacterized protein

Sequence
17173 bases(100 bases per row)
GATGGTCAAGACGGTGAGCAGCAGTGGCCAACTCGTGGCCGCGTTCGGTGTTGGCGTGGCGGCTGCAATTGCGGCGCAGTATGTGTACCAAGTTGCACTA
AAGCGGAAGCCATGTGCGTCGAAATCGGTCGTTTCGACTGCACGGGGAACGGATGCTGCTGCACAGGAACTGCTGGAGGAGCAGTTGTCTCGAATCTCCT
CCTTTTTTGGGCCGGAGGGATTCGCTAGGGTTAAGAACGCGTTTGTGGTGGTCGTGGGGCTCGGTGGTGTGGGTTCTCACGCTGCACACATGCTGGCGCG
CTCGGGTGTCGGTAAGCTGCGGCTCGTTGACTTTGATAATGTCACGCTGTCTTCACTGAACCGCCACGCAGTGGCCACGCGCGGTGACGTGGGGCTGTCC
AAGGTCACGGCCATGAAGCGCCACCTGCGTGAGATTGTACCGGACTGCGAGATAGAAGACATGGCCGTCATGTTTGAGGCGGAAAGCGCTGACGACCTGC
TGGAAGGCAATCCAACGTACGTGCTGGACTGCATTGACGACGTCAAGACCAAGTGCGCATTGTTGGAAGCTGTGACTAGAAAGAGACTCAAGGTTATAAC
AGCGACTGGAGCTGGTGCCAAGGCCGACCCAACGCGTCTGCAGATTGGGTCGCTCAAGGATGCTGTCCGTACGTTATGCCTGCTGCGTGGTTGGGCTGTT
GCAATGAAAGTGCTTAAATTTTTTTGTCATGTCCGGTAGGTGACCCGCTTGCTACGAAGATTCGTTACTTTTTGAAAAAGAAGGGCATTTCGTCGTCAGA
GATCACGACTATCTTCTCGAGTGAGAAGAGCGTATGCAAGCTGCTGCCTTTAGACGCCGAGCAGGCGCAGAATCCCAAGGAGTTTGGCAACGTCGAAAAC
TTCAGAATCCGTGTCATCCCTGTGCTTGGCACAATGCCTGCGCTATTCGGGCAGTCCATGGCGGCGTATGTTCTGTGCGACTTGGCTGGCAAAAAGATCA
GTCCGGAGGCGGTGGCACGGCTGTCCCGTGACCAGCGCAACAAGCTGTACCAGAAGTTGCAGCAGCGTGAGCACGTGCTGTTCCACGAAGGTCACAAGAT
CGAGCTCGAGAAGGATGAGATTGAGTTTGTATACCAGGAAATTTGGCGGGGACGCAGCTCCGTGAGTGGGACGCGCAATGGTGGCCACGACCGCTTGTAC
TTGGCTCGCTGGCGGACGGACCGACCGCTGCACCCAGACAACGTGGTTTATTTGACCACAAAGGAGCTCGCCATTCTGGACAAGAGCGGTATCGAAGGTT
TTGACTCTGAGATCGTTTCCCGCATCGATGCTCGACTGAGCCAGTTCGGAAGCTGGGCCGTTCCTCAGTGAGAACTCCCTAGAGCTGCATTAGATTCACG
TAGAACTGCTCGATAACATGAGCTCGAGGTTTTGTAGACAGCACTCGACAATCAATACCTATTTGAGGCACGTGACATGTGCTATCCAAGTAGCGAAAGT
ATTGAATTCAGTATGTCTTACAAATTGTAAGACATACCCCGTTACCTGACATCCATGCCGGCTGCAATCCCTTTGAGAGCTACAGAACCTGCGTCAATAT
TCACCATGGCCACCACGAAGAAAGTGACCCAGCGGCTTAGCCGCGATTCATTCAAGCAATGGATCCAGGGCCTCGATGCCTTCCTCTTCGACTGCGATGG
AGGTACAATACGCCTGTGTTTTGATTTTTTTTAGTCTCGTCGTCACTGACATTGGGCTAATTGCTTTAATATGACATGACAGTGCTGTGGCGTGGGGCTG
CCCCGATCGAGGGCGCTGCCAACATGATCAGCCTTCTACGCTCGCTCAACAAGCGCGTCGTGTTTGTGGTGAGGTGAATCTGGTCCTACTTGTGCACAAG
TGGAAACTGAAACTGTGATGGGAATGATCCGCTCGATGTAGACCAACAACGCCACCAACAGCCGTGCCACCTACGTAAAGAAACTCGGTGGGTGCTAAGA
CGATGAAACTCGCTGAGCTTGGGATGATTTAGGGACTAATGGGTAGTTTTGGTGCGCTACAGCGTCGCAGGGCATCACCGCTGTCGAGGGAGATATCGTC
ACGTGAGTCCTGCATTGATTTTTTGTTTTTATATGGTTATGCACGCCCCAGCTAACGAGCTAGTGAACGGTTGTGAATTGTAGCTCGGCGTGGGCTACGG
TGCAGTACATGAAGCAGCACAAGATTGAGGGCAAGGTGTACATCGTGGGTGAGGCCGGTCTCAAGACGGAGCTGGAGTTGGAGGGCTACCAGGTCAGCGG
CACGGAGCACAGCGACATCAAGGGCCTCCCACATGTGCCGGATATCGACATGGAGACGAAGGCAGTTGTCTGTGGCCTGGACAGGTTTGAAAGTGATTTG
GACGCTGCATCGTTAAAATTAAAGTAATACTAACGCTATGATATTACTATTGCAGATACTTCTCGTACTACAAGATGGCGTACGCTACGGCATGTGTCCG
TCAGATCCCTGGCTGCCACTTTATCGGCACTAACCCGTGAGATTGTGCGTGTACAATAATTTGCTTAGCGGCTTTCTAACAAATGAGCTTCACTTTTTGG
TGCAGTGACTCGACTTACCCGACGGATGGTGCCATCATCCCTGGCGGAGGCTCGCTAGTCAACATGCTGGAGTGCGCTATTGGCCAGTACGAATCAGCTT
ATTTGTATTGTTTCTCAATGGCTTGTACGCTTATCATTTGTGTTGTCTTTGATGCGATAAAGCCCTCCGGAAGCCGTGTGCGGTAAGCCTTCGCAAGATC
TGCTGCGGACCATTATCGCCACTTACAATCTCGATCCCTCGCGCACGTGCATGGTATGAAGTCTCCGATTGCAATGCCAAAAGTGAAGTATGCTAATGTA
ATTGGTGTCGTTCCTGCCTAATAGGTTGGTGACCGACTTTCGACGGACATCGAGTTCGGCAACGCCGGTGGCCTCAACACTTTGCTGGTGTTGACTGGAA
TTACGCACGAGTCGGAGCTGGGCAGCATCGAAAACGCTCTTTACGTGCCTGACCACTATGTTGACTCGGTTGACGTGATCAACCAGCTCCACGCTGAGAC
GCTAGAGAATTAAAGGTGCCCAAGCGTGGTCCAGGACATTGCTGTGGCTACCGTCTCATCAGCTACGTACCCAATAGATGCAATCTGTTTCAGCTGCCGT
TCAATATTGTCAGCCCGCTTGTTTATTTGGCTAAATCACGCCTTGGTTACCAGTAGTATCTTACACTGTGAACATCTTCGCCATCTATCCTATACGGACG
GTGATCCGCTTCGAGTCTTCGTTTTCAGTCTTGGAATTGATCCATTACTGCCACTGTTCACGAAAGCGTCGAACATGGAGAAACTACCGCTAGTTACTGC
TGCATTTACACCCCCTCCAAACCGGTTTGCGTTGGTGGGGTTCTTTGATCGAATCGGAGCTGAATTCAGTCGGCGCGTGCTAGCGGCAGTAGTGTTGCGG
AGAGTTGAGCTTCGGGGTCCAGGTGACGCAGCTCTTGGCTTGGTGAGACCCGATGCGACCACTGGGGACATTAAAGGGGTTGGAGTCCGCAGATAGCGCG
GCATCGGTGACTTAGCCAAACGCTTTGTGATCTCTAGAAACTGCAGCTTCTTGGTGGGCGTCACGTCTCCTTCTACCGCCCCCCTTGGTCGTTTTCGCGT
GATGGCACGTAAATTCTCGGGTGAATCATTGTCGCTGATGAGTCCACTGCTGTTCAAGCTGATGTTCAAGTCTTCATCGATCATTTGGTCGCGTCGTGGG
ACGTCTAGCTCTGCTGTATCACTCGCTAGCACCTTCCGGAATTCAGCTCGTTTCACCGCCAACGTCTTCGCTGCTTCTTCTTTCTGGCCCTTTTTGGTCT
TCTTTCCCAGCACTTTTGGAGTGCTCACATCTTGCATCTTGTTCATTCGGGCAAGCAGCTCAGCATTCGCTAATCGTTGCTTAATTGACATGGTCTCACT
TTTTCCATTTACCTTCTTCTTCGTTAGCGAGGCCTCTTCTCCAGATGCGTTGACAGTCTTCATCTGGGGTTTCGTCTCAGTTTGAGAATCCTTGCTAGCA
TTGTTCCCAACAGTCTTCTTCCGTGTATTATTGCCGGCTGATGTTGTTGTTTTAGCTTTGTGCGCCAAAGGCTTTGCTGCCTCTTTCCCAGATTCGACTG
CCATCGCGGTATTTACTGCCGATGGGGCAGCTTTCAAGTCCTTTCGACGTCTAAGACGCTTCTTTGGTATCGGCGTCGGCATTGGCTCGGGCTCAGCATC
TGCTTCGTCGCTCTCCTCTTGCTCGGCTTCACCTGCAGCCTCGGCAATTTTAGCCTGTCGCCTCGCTTCCGCGTTAGAGAAGTTAAAATCTAGCGGTGGG
CCTCCCTTCCTCTTCGCGAAACGTTTTTGTGGCGTCGGTGTCTTCTTCTTCACCGGCGACTTCTGCACTCGCTTGGGAGATTCTTGAGCGACTGGTAGAA
TTAAACTCACCATAGACGGCTGGTCGTCAGCCTCATCAGAGTCGCTATCTTTATGATTCGACAATATGCCAAGAAGTCCGTCGTCCGGTAGCTCTGGCGG
AGGGCTGTCATATCCTCCAAGCTCATTCTGGTTCTCCTCGGAAACGGAGTCGTCACCTTTAGGCTGAGTCGACGGTAAACTAACAGGCGTAATCCTCTTC
GGTACGACTGACTTCGTCTTCTGATTTTGCGTCGGCTGCACCTTTGACTTCATCTCTTTTGGTTTAGCTGTCTTGGTCTTCACCTCCTTCAATTTACCCG
TCTTGGCCTTCATCTCTTTCGATTTAACCGTCTTGGTCTCCTTCTTTCGACTCGGCGCAGGCTCCTCCTCGGCCGTCTGCGTACCACTCTCAATCACCTG
CTTCCTCTTCCTTTCTATTTCCTCTCTCTCTTTCTCCCTGGACAGAGCTGCTTCCTTTTCGCGCTCGCAGCGTTGAGCCTCCTGCTCGTGCGCCTGCTTC
TCAAGCTCCTGACGCTTTATTCTGCGCAGCTGGCGCCTGTACCGTAACTCCTCCTCCTCCATCGCTTCTGCTAGCAGTAGCTGCTGCCATGTTTTCTGCA
GCCGCTGGCGCCGCAGCTCGATGGACTCCCACTGTTACAAGCACAAGCATCAAAACGTCGGTCAGAACCCGGAAAATGTCGGTTTCTACCCGGTAAACGC
ACGCACTTCCAGGTTGTACGCCTCAAGCAGGATCTCCTCCGGATATGGACCCCCAATATAGGCCATGGCACTGTCAGGCGACTCCATGTGAGCCTCACGT
CGCAGTGCTCGAGTCGAGTGTAGCGATTCGTGCAGTTAAGGTTTGGTACATCATTTTGATGGTGTCATAAAAGTTAAAGCTGTTGTTGTAAAGGGATTTT
GGAGACATTTCTCCCTTTAAAAGATCAGAAGCATAATCCCTTCATCGAAGCAGATCAATCTCAAAAGGGAGTCAGTCGATACAAACAGCAAGGCAATTCG
CACCATGGTAGGGGGCGACGCGAATCTCTTCCAGCTAGCGGATGGCATCTCGTGTCACGCATGGAACAAGGACCGCTCCAAGCTGGCCATCTGCCCCAAT
TCGAATGAAATCTGGATCTACTCGGGCTGCCACGCACCCAACCCGTCGCAATGGCGCAAGGAGGCCGTGCTCACGGAACACGACATGCTTGTGTGCGGTC
TGGACTGGTCGCCTGTGCATGATCAGCTCGTGTCTTGCTCACACGACCGCAGCGCTTTTGTGTGGAAGTATGAGGCTGCTTACCGCCAGTGGAAGCCGCT
GCTTGTGGTTCTGCGCATCACACGCGCTGCCACAAATGTCAAGTGGAGTCCTGACGGTAAGAGGGAAGCTGGAAAGGCGAAGCATATTCACGGTGCTAAT
GGTTAATGGATGGTGTCCGCAGGCAAGAAGTTTGCTGTGAGTAGCGGTGCCAAGTGCGTGTCGGTGTGCTACTACCAGGCAGCGGAGAACTGGTGGGTCA
GCAAGATCATCAAGAAGCACAAGTCCACGTACGTAGCTTCAACTTGGCATTTATATTGGGTTCGAAGGGGGATACGAAATCTATGACTTGCAGGGTGACG
GACTTGGACTGGCACCCGAACAGCCAACTGCTAGTGACTGCCAGCACGGACCTTAAATGCCGCGTGTTCTCAGCGCACATCAGCGACATCGATGGACCGC
CTGACGCGGGTCCGTTTGAAGCTTTGCCGCCGTTCGGTGAACCCCTGGCGGAGTTCGACAATGCCAGCGCGTGGGTGAACGCTGTTGCGTGGTCCCCTAA
GGGCAACCGCTTGGCTTTTGCCGGCCAGGGATCGTCCATTCACATAGTGCACTTTGGTGCGCCTGGCGAGTACCCAACAATCCAGGTACTTTGAGATACA
GTCTCGTGTGGCCAAGTGTGGAAAAACTTATTGTGGCTTTTGATACAGTCGATCCGGCTCTCGCACTTGCCGCTGATGCGCATTATGTTCCTGTCGAACG
CTGCGATTGTCGGAGTTGGTTACGACTTCAACCCTTTGCTTTTCTCCGAGGATGCCAATAACTTCTGGTGCGTAATTAACCAAAGAGCATGTGTCATAAA
TTGCAATAGGCTAACCGAGTCATCCATTCCTTTAAATAGGTCGTTCTCTGAGTTTGTCGACAAGAAGCCGACTGAGAGCGCTGTCAAGAAAAATGCGGGT
GGCTTCAACGCTGGTACGAACAGTAAAGCTGGTTCGACTGTAACTGGATGCTGATTTTTTCTTACGTGTTCGTTGTAGCTCGGAGTCTGTTTGAAAGCAA
GGTGACGAGAGGCCAGTCGTCTGATGCCACTCAACTCGATAAGAACATGCTGTGGATGTACGTTTGGTCTGTCGTCGTGCCAGGACTAACGTCGTTGTTA
CTGACTTTTCGCCTACATCATTTCAGGAAACACGAGAGTAACATCACATGCATTCAGCCCTACACCAAATCAGCCTCTGGTGGCGTCACGGAATTCTCCA
CCTCTGGTTCGAATATGAGTTCTTGCTTTGCTTAGAGTTCTCTGATGTGCTAACAACTACTCTGGTGATTTTTCGCTGTAGCTCTTGACGGCCGCGTTGT
TCTGTGGAAGCTGGGAAGCTTGAATGTGGAATTGAGCAAGCTTCATCTGTAAAAGGATACTGTGTTAAACGAAAGCTCTGCGATTCACCTGTAGACTCGG
CATTAAACAGAAACGCCCCGTTGGTGATGCTAGCGGAACAAGCCTGACACTACATGAATGGACAATACACTTGTCTGATGATTGTTCTGTACATCCATCA
CTCTACCACTTGCAAGAAGCGCAATGGCACCTCTATTCGTACATCCGCTTTAGTCGTCTATACTCCTGGCGATACTGGTTCTCAACGACAGAGGCTTGGC
GGAAGTCTTTCCACTCGGGAAACTCCGTGAGCAGTACCTTTGGGTCATAAGATAGCAGCAGCTGGATGCCCTGACTAACGTCGTTCAGCGTACGCGCAAG
ATCAATGTGGTCCGGGTTCAAATACGTCCGCTGAAGTTCGAGCAGCTCATAACTGCTACGCAAGAACAAAATCGAGTACTCGCACACACGTTCGGTCTTC
CCACGCAGCAATAAGTCGCACGAATCTGCTACCAGTTTATGAATGCGCATAAATACCAAGTGATCGTGGGCGACGATCTCTAGTGCATCCGACAGCGTCT
CCAAAGCCACAGATAGCGCGTCAGCAGCACTCTCGGGGTTTGTCTTGATAACTTCTTCCGCACCAACCAACACCTTTTCCAAATCCGGCATGCCAGGCTT
TGTGTCGTCGCTGTCTTCCACTGCATTCGGAGGCGGAGATAGCACACTGTCACCTCGTTTGCACAGCTCACAGCAGCACTCGAAACCAAACTGCTCCGAC
AGATTCTTCTGTCGGTTTCCACGACTCTGCTCACGTGGATACAAATACGAAATCGTAAGCTGCTCGCCCTTGGCGATTGGTCGCGCGACCCGCACCTCGG
ATACCCCACCTTCGGGACCAGCATCTTCCGGCGTAAACTTGACGCAGTTCGGGTTGCAGTCGTGGTTAAACATGGCGTTATATAAGAACACGCCGCTATC
GAAGGCGTTGCATTGCATGGCAAATACGTTCTGTAGCACTTGGTCGGGTGACAGCGCCAACTCGGTGAAATTCCTGCACAGCTCGTCCACCTGGGGACCG
TACTTCTTTCGGCCTGCAGCGAGCAGTTCCTCGGGTAACTCGCTAAGCTTCTCAGGGTACAGATGCCCCAAGTGCTCCATAATATTGGAGTAGTCTGATC
GAGACAGCACAGACTCCATCGTGGCCAAGAAAAACTCGGGGTCCGAAGTCTCCACGTCCCTCGGCCAAGGCACATAAACCTGTTCCACCAGCACCTGAGT
GCCTGGTTTTAAGTCTCTCGTGGCCACGTAGCCTCGTGATCCTCCCACGCCATTGAAACTCGTCACAAGGTCGATAGGACCCACCGCCAGCGGTTTAACG
TCGTCCCAAGGCTTGTATAAACTACGCGTAGCTTCAGCCCTGAATTTCTTCTCCTCCTTTGCAGCGGGTGAAGGCACAGCAGCCTTGGGGACGATATGAA
CAACCTCGTGTGGTTTTACAAGCGGTGGCGCCGTCTCTTCGTCGCTGCTGTCGTCGTCAAAGAGTCCAAAGGCAGCCTGCACTGACGCACTGGGCTTGCC
ACTCATGCTGGTTGGACTGACGTCGAGTTTATCAAAACCGTGTGTCAAACATCATTCGTGTACGATTGGTGTGGTGTTCTTCCCCCTCCCTTGAAAAACC
AAGTCAAAATACAAAGTACCGACACCTCCCTTTTGTGGTTCCTGCACTTCTTGATGGCCGACGAATTGAGTGTCACAGGGCGGAAGCACCCACGCGCACC
AACACAACCGATGCAGCAACTCCTGCCTCCTGACGTCTCCGCTTTAACCACTTTCGCTTCCGAAGCCCCAGTTCAACCGCCGCAGCAGAATGATATTGTT
GTGCATCCTGCCGCATCTAGCACTTCGGGACTGCCTCTCGGTCGCCGCATGCGTCTGACCCTCGGTCAGAAACGCGAGGTGGTCGACCTCGCAGCAAGCA
AGAAATTCACGCACCGCGAGTTGGCTGAGAAGTTTCGTGTGGGGCGCACTACGATCACCAATATCTGCAGACAGGAAGACCTTATCCGCACGGAGACGGA
CTCGGCTGACGCTACAAAGAAGAAGAGGAAGACGACCAAATGCACTTACGATCTGCGAGTGCTGGATGAGTGTCTGCACAAGTGGAGAATGGAGGTGAAG
GTTTCTAGCCCTGATACTAAGCTCACAGGCACCGTATTGCAGCATAAGGCCATGGAATTGGCCTGTAAGATCGTTCAAGAGCCTTATGCAGCGTTGCCAG
ACAAGGTGAAGCAGGCACTACAGAAGTTTACAGGCTCTAATGGATGGCTGGACGGATACAGGACCAGATTCGGCTCATTCAGCAGCAAACAGCTCCCTGG
TGGAGGAGATCAGAGTGTTATTAAGAGCGTGGACATCCAGACGAGACTTCGAGAGCTGCATCTTGCGTTTAGTAGTGTGGATCTGGAGGATATCTGGACG
GGAAGTGAGTTTGCAGTCATGTACAAACCACCAGTGGCTGAGTCGGTGAGTGGCGCTGGAGCCAACACTGGCAGGTATACAGTCTCGTTATTCGTGAGTG
CTGCTGGAGAGAAGCACGATCTGCAAGTCATTGGTACGGACCGAAGCCCTTTGCTTTTGGAAGGTATCGACACCAAGGAGACTTATAATATCCAGTATGG
ATACTCCAAGACTGGCTGGCAGGTGGCACAGACGACCGTCAGCATGCTCAAGTCGTTGAATGCACTTGCTAAGGAGCGTAAACGCACGTTCCGAGTGATT
TTGGACTCGGCTGTGCCTCACGTTAAGGCTGCTATGATTTTGGATTCTCAGGGCGACCAACGCACATTCTTCGTGTACGACCATCTCCACATTTACTTCT
TGCCGCCTAATTTCAAGGCGCCGCGTTTCCACCCGTGCCACCTTGGAGTGATCCAAGCATTCAAAGCGCGTTTCCGTACTGAGATGGTGGAGACACTATT
CAATAATTATCGACAGAGCTTGATGAGTCAGGACCCTCGCGGCTTCCATCCACAGCGCCACTTGCATACTCGCAACGTTTTCCACTGGTTTTTCGTGGCT
CTCCACAGTATTGACAAGCAGTTGATCCAGAGTTGCTGGGTTCGGAGCGGGTTGCTTCCGACCCAAGCTATTGCGTCGGTCAACTTGCGTATCGTTTTGA
GTAACAGTGCCAATAGCTCTTCTCCCAGCAGCGGTACCGACAGTGGCAACGGCAGCGTACATTCCGATGCAATTGGAGTGTATGGCGTGTCTCCAACTGG
CTCATTTAAAGGAGCTGGGTTATCGCTGGCTAATGGAGTCTTGCCATGTCCAACTCTACTATATCGAGAGCTGCAGCAGCAGTTGACTAGTATCGCCCAA
CTTGCTCCTGACTTCTTTCGGTGGATTGGCGTGGCTGAGCCTGCGAACGCTCAGGCATTCGTAGATCTCGAAGGAAACGCTTCTGTGACCGATCCAGGAA
TCGACGAAGTTCAGATCATCCGTGGCGTGCTCCAGAAGCACGGATACTTATCCACCAAGCGACTTGACGATGAAAGCCATGCAAATGGGCCATACGAAAC
TTTCGAAGACGTTGCAGATGAGCCCTGTCCGCGACCAGAAGAAGTTCTAGCATCGGTCAGCATCCTGAAGCGATATTTGCGATTGTCCCGTGAAGCAATT
CCTACTCGTGTTGATGCGATTGTACAGCTGAACGAAGTCAAGAAAGCTGTTGACGCTGTCGCCTTCCGTGACGCCGCTTTATAAGTGTTAGCGTGAGTGC
TTCTAGACATCGTGTTCACTATTTTATTGACTGTTGTCTTGTCATTTATCTTACAGAAACTAAGCTTTTTGATTGTCGAGCTAAACTAAGCTAGTACACG
TTCCGGATTTTATAATTGGGAGGAATCACATAGGCTTCATCCAACCGTAGATCTGTCCGAGCTGCGAATGGAGACAACAATGGAGCTGCGCGTGCCGGTG
AAGACACGGGAGGCACCAGATCAGGTACCAGATCGTCTTCCAGTGGCAGTATTGTTCGCTCTGCTATGGCTTGCTGCTCGATACGTCGCTGACGCCTTGC
ATAGGCCACGAGTGTACGTAGTGCACTGACCAGCCAGTCTCGATGGCTTGAGCTCTGTGTCTCTAGATCCAACGTCCGTCCTCGAAATACTACTGAGAAC
GAGCAGGCGTCGAGCACACTGTTGGAGGCGTACTTGCGAAACACAGCCGTCTGTCGTCCGTCCAGCACTTGCAGCACTTCAGCCAAATCTACGGCTTCAC
TGAGACCACCACGCTTATGTTGCCACTGCAGCGTACCACAGCAGTTGCAATGCAGTCTGGTGGCATGTGCACCTCCACGTCGTCCATATTTCAGAAGAGG
GAAGAACATATTGATCGCCTGTACCAGATACGACCGGTGCTTGCCGCCGAAGCGGAAGGCCAACTCGACGATCTTCCATCGAGCTCCTTCAATCGTCTCG
AGCTCTTCGTCTGTGAACAAGTACGTCTTGCGCTTCTTGCGCAAATGAAGAGTCTCCAGCACACGCGGGCCGATCCTTGAGAACGCGCTTTTCTTGTGTT
TCTTGCCAGGGTGTATCTCCTGCGGGGCCAGAGCGGGACTAAAAGGAGGCGGCGTCGGCATCGAAGACCCATCGACTGGTGACGGGACGCCAAGATCATA
AGCAGTCGGACATGACCCAGCTCGCCTCCGTGTCGGAGCCGGTCTCGATTTGAGACGTAAGCCATGAGATTGGGCCAGTGGTTTGCTCATCTGATCCGAG
TCGTCTTTCAACTGGATCACCAGCCGTCGCACACTTGATGTAAGCTGGTCCTGTGCTGACAAAGCTGCATGTTCGGCTGCACAGCTCAGCAGGCGAGTTT
GTCGACGCTCTAGGAAATGGTGCTTGGTTGGACTCGAATCTTGCTCTGTCTGAGCTATCGTCTCCTCTTGCTCGCTGCTGGATCGTTCCTCGTCCAGCTC
AGAGCTGTTCTCGACCAGTTCAAGCTCCTCCACGTCGTCGATGTGATCTACGTCTTCTTCATCATAGTCCTCGTCGTCATCGTCCTCGTCGCCATCATCT
TGGTTTGACATATCTTCAGGCACATCGGACTCGCTCATAAGGCTCTCGCTCATAATGCGGCTCATCAACCTGCGCACGCTCGACGGCATGTGGATCGAGT
CAAAGTTCAGCATTTCGTCTTCTGCAAACGCTCCGCCGTTTCGTTTACCATCGTTTCCAGCCTCAGTAGGATGCGCAAAACGTCGTTCCTCCTCTTCCAT
GTTCTCCTGTTCGTTGTTGTCCATGTCTCCCACTTGTTGGATGCCCTTCTTGTCTTCCTGGTCGTTCTGAGGCGTCGACGACGGTGCGAACCTTTCGTGC
ATAGTGTCAAAATCCTTCATCTCCGCTTCGAGCGTCGCTCTTCGCATCAGTTCCCCCTGACTCAACGGCTTTGCCAACGCAGCCGCTACTAGTGGCCGTG
CCGGATAAAACTGGAGCCGTTGACTCGTGCCGCGGCCGTTAGTTTTGGGGTCCCACATGGTCATATTCGCCTGCATCGTGGGCGCACCGACGCTGCGGCG
CCGCGCGTGTCGGTCTTTTCGCTGTGTCGCTCTGTCGTCATCGCTCTCCTTTTCCTCGCTGTTGTTGCTGCTGTAGCTGCTGTTGCTGCACCGCAAGTCC
TCGGGCTCGGCCTGGAATACACTGCCACGCCGCACGATAGCCGACAGCTTGCCCAGCAGCACGACGCTGGACGAGCGTTCACGACGGCCGCCCGACCACG
GCTGCATTTATCAAGAGGACGAATGAAAAAATCCACGCGGGAGAGTGGGAGCACTCCGGACTTGTGGCCCAACAACGCGGAATGAGTGCCGGCCAAGAAC
GAACCGCCGGCAGGAAGGAGAAAACCGTCGGACACTGGCGCAGTAATAGCAAAGGACAGATGCCAAGCGATGGAGAAATGGCCAGCCCTATGCTTTCTTT
CTCTGGACTCGTTGACCAGAGTGGTTGTGGCTGCTGACTACTGTGGCGTACGAATGGGCGCGATGCTTAACCGGGTGCCGTTGTGCAATTGGCGAGTGAA
GTGTCTTCAATATGTCCAAACGACGTATCCAAGTTAGTTTCAACAGGATATTCGTTTTAAGAACTAATTGCTGAAAACGTTTCTGTTTTCGTCGACAGAC
CAATAATATAAATGTTGAGAAGAATAAACACAAGTCTCAGCTTAGCGCAGGAGCCGTTATCGGAGCTACCGGTCGGGAACCTGGACTTGTCGAGGTGAGC
AAGGTCGAAAGGCTCTTTCAAAGAGACCATCGGCACCAGCGGGCTTTTCTCTACCATATTCCAATAGCCTCCATCTCCTTCTACTGTACCTGGACTTTGC
CGTGCCTCAAATGCATCCAACCAGCCGCGTGGAATCCACAGCTTCAGCTGAATCACCGCGGGTTTGCTGGACTCCCCAAGCCGCACCACTTGGCAACTTG
CTACAATTTATTGACGACGTTGCACATCTTCATTTATGTGGCGCACATTATGTCACTTCGATTCATGTAGCTTTCAATATTCTTGAACATGGTGAGTGGA
GGCAAGAAGCCTCGTCGAAACGATGCGCAGCGTCGGGCCAGGCTCCAGGGCTCCGGTGCGCTGCTGCAAAGTAGTCTAGATACTGCACACCCTTCTTCTC
GTCTACTTGTATGGCACTCGAACTTCTCGCACGGTGGGTCTCGGCACAAGAGCGTCATCAACGGACACGCTTTCAACCAGCAGCTCGAAGTGTATCTCCC
GTCCAAGGAGGGGAAAGCGGTCGCGCAATCGCTGCAATGGGAAACGGGCTTTTACTACGAGATCAAGGCGTCAGTCGACATGTTTCTGTCGCCGACCTTT
ATTCGCGACTATCTGATGGATGGTGGCGCCGTGTTCATGGTGGCCAAGAATACAGCGGTGGACGCGTCGCAGTCGGCGATGCTGCTGCCGTCCGGACAGT
TGCTACTGTTAGTGGACGCAGATACCTACCAGCAATTGGGCATTGTAGGTGAAAAGTATGGCAAGGCAGTGCCTGCCACCAGCAGATCGGCTCACGTGAA
GCAAGCACAGAAATACGTCATCACCCTAGACTTGACGTCGTCTACATTCGCTGGTGAAGAAGTCAACACCTTTAGAGATCGAGTAAGAAAGTGTCTGAGC
ACGAAATTGGAGGATCTTGAGATGCTGCTGTGCGCGTACAACCAGCGTGGATCAGCACGCACAATCTTGTTCGGAGATGATGATCAGATACCTCGTTCAC
GCGTGGAGCTAAACGCCAAAATGACGACATTCAGCGACGTGTTCCTTCCCAAATTCGACGCATTTTACAAAGAGATAGCTGCGGTTGAAAAGCGCGGTGC
GGAGGATGGCAATACACTGCGGACGTCGCTGCAGGAGGCTTACGACTGGTTGGGAGTTGTGGCGTGTGGGTTGACCGACTTGCTGCAGAGACAGAAGCTA
GAAGAGTACGTGTCGACGTTCACGGGTATCCCTGATTCATTTGAGAGCGTGCCAGGCGATGAGATCACGACGGTCAGATGGCGTGGTCTGCTGGCAGCTC
CGTTTTGCTCGACTATTGTGGAGAAGGTGCAGCGTTCTGTCAAAAATGCCGAATTGCCGTGGGCTGCTGTGACGGTATGGGGCTTCCCAGATGTCTTCGT
GTCTTGGGTGCAGTCTAAGACAAGCAAAGGCAAGAAAGAGAAAGGCGAGCCTCAACGACGAGAACACGGCTATCTGGGTAATGGCAGCAACAACTACACT
CTGCTGATACTACCGAACGAAGAGTACTTCATGCTTCAAGCACTAGGCCCCCATGACGCCACCGTGTAGAATCAATTACCGCTTGCTAGAATAGAAACAC
TGCCAGCATTTACATGTAAACCGTGGGCTTCACTCTAGTTCGTGAGAACGTTCTCCACGAACGCAGCGACAGTTGATGAGCTCGAGTCTGCTCCAGCTTG
GGCGAGCGATAGTGCGACCTTAATGTGCTTGCAAGCCGGCTTCACGTTGTTTTTTCTGCCGTGAATAAGCGCCAGTCGCAAATTAGCCAAGAAACACGCC
GCCGTATCGCTGTTGCTGCTCAAGGCAGTTGTAGTACTGCTCATGTTGTCATCGCCATCGGTGCAACTAACAGACTTGGTCGCCGTTAACGAGGCCACAA
GCTTCCACAGATTAATAGCAGCATCCAAATGGTGGTATTGTTCGTACAGCCCGCCAAGCTCAAGGAGGATCGGAATCAATCGCCCCGAAGACGTCGCAGC
GACAGTGGCAATCACACCCAAATACTTATCGATAGCCTTCGTTGGACTTGAGATCGAGAGCAAACGAGCTTTCAACAAATCCATGTCCACTGACGACACG
AAGGCGCCACTTTTCTTGCCTGCTTCCACCCGGCTCAACGCTTTTTCCGAGGATGCAATTGCCTCGTCCTGCTCACCAAGCTTAACGTGGCAATAGCTCA
TCAGCAACTCTAGTTGAGCTGTGTCATAATCTTTTCCAACAGCAAGAGCCAATCCATGCTGCAACAAGCGCAACAGTTGGCGAAGAACTTGGTCGTGTGA
TGCTTGCTTCTCCCTTAGACTCACGCGCTTCAGGACGCTCGTTCCAGCCAGAATGTAAGCGTGAGGGTTCCAGGGTTGAGCACGGATCAGCTTTTGAGCA
TCCACGCACAACCTGTTCGTATCGGTTGGACCAGCCTTTACTAGACCCACGAGCGCGTCGAGGAAGGTGCGATCCATCGCCTCATTACCAGAGGATGGCA
CATTTCTGGCACTTGAGCGCAAGTATTCCGTAAGGCAACTTGACACCTGAAGGCTTTCAGAATCAATCGTTGCAAGGGCCAGTCGCATCCCCAGAGTACA
AGAGTTGGCGCCATCGCTAGTTTGTGAGAGTGCCTGCAAGCGGGTCAAATAGGCGTCTTCGGCGCCCACGCATCGTTCATGAAGCTCAACCAGACGCAAG
TTCAGGTAGTCACGTGTGGTAAGAGGTGACTCCGCGTCATCAATTGATAGAAGGAGACGTTTCTTACATGCCTCAGCTAGACCAGCGGCCTGAGGCGTAA
ACTCGTCCATCGACAAGCTCGCCATCGAGAGGCCCACTAGAGCAACCACTTCACTTTGGATGGACTGGGAGTCGTCTTGCTCCAGCAGCGCCTGAAGTTG
ATCCAACGCCTCACCTCCCTTCGACTGGCGGTATAGTAGCTGCGCTTGCACGATAACCCGCAGTGCTGAGGTCTCACTTGACGATGAGTCTATTTGTGCG
GCAATTTTCTGCAAGAGTGCTAATTCTTCCGTGGTAGTGCACTGGGGTGTACTGGAGAGCTCGCCAAGCTGTGTCACCAACCTGTTCCATTCAAGTCCAT
CAGTAGCCTGCGTTGACGAAGCTGCGCGGGTGTACGATGCCAAAGCCTCGGTGTACAATCCAAGTCGATGCTGAGCGACACCGAGGGCGTGCCAAGCGCG
TCCGTTGAAAGGATCCCGCTCCAGGTACTTTTTTAGACAGAACATCACCACCTCATTACCGTGCTCTGGGGCTTGAGTGACTGATTCACCAACACTTACT
CCGAAATCAAGTAATGCCATACTCAAACCAAGCAAAGCATCCAGATCCAACCCGGTCTCCAACGCGCAGTCGAAGGCTTCGATCGCTTTTTTCTGCTGAA
CTGTTGAGCTAGCTTGTCGTCGAGCCAACATTGCATACCCATTCCATATGGACGGATTGCTTGGGTTCATGCTCTGCAGTTGGAGAAACGACTTTTGTGC
CAAGGACGCCGTTGAGGACACAGTATCAGCCAGAGTGAGGTAGAACATACCCAGATTGGCCCAGGTGGCGTCGCTGCTAGTGCCAGTTTGAATGGATCGT
GTCCAAGCAAATTGCTTCACCAGCAGATTGTCAGACACTAGAGCCAACCCGTTCCAGGCCAACGAGCATGCAGGACCCTCTTGAAGAGCCAGCTTGAAAT
TCATTGACGCCTTCGCCTTCAGTGCTACGATAGAAGAGTCTGCATCGAGTCCTGTCTCACCTGAGAAAGCTGA