Description :
From Genome Similarity Track
Location :
contig_14:248184- 249879
Transcript NameFunction/comments
g3507.t1POM76356.1 Putative Glycoside hydrolase [Phytophthora palmivora var. palmivora

Sequence
1695 bases(100 bases per row)
GTGGGATCTTACCTTGGACTTCCATTATCGATCTTGGGTGAAGTCAACGGAACTTGGGGCTGGACGACGACAGAAATGCGAGCCTTCATCCACCGCATTC
AAGAAATCACCATGGAAGAGAACGGCGGTCACCCAATGATCTTCGGTGTGGATGCTGCTCACGGAAATTCACTTCTGTCAGACACGGTGTTCTTCGGTCA
CCAGATCAACGCTGCTGCCACGTTCAACCCGGACATTGCATACGAACAAGCTCGCATCACTGCACGTGATGCGCTAGCTGCTGGCATCCCTTGGGTCTTT
GACCCCGTTCTCGACATCGTACACAACCCGCTGTGGCCGCGCGTGTACGAGACGTTCGGTGAGGACCCGTACCTCATTTCCACCATGGGGGTCGCCATGG
TCCGTGGTATCCAGAGCTACAACGAGTCGGCCGCATGCATGAAGCACTGGATCGGCTACTCGTGGAGCGCGACTGGCAAGGATAAGGACGGCGTGGAGAT
TTCAGATTATGACCTCATGAACTCGTACTTCCCGCCGTTCAAGGCCGCTGTGGATGCAGGTCTGTTGACTGGAATGGAGAATTACATTTCCGTGAACGGT
GCCCCTGTGATCGAAAATACGAAGCTGATGACGACGTTGCTGCGCGAGGACCTTGGTTTTGATGGTTTGATGGTGTCGGATTATGGTGAGGTCAATCACT
TGGTCGAATTCCACCGTACTGCTCGCTCGATCCACGAAGCCACTAAGTTATCACTAGAGCGAACGTCGGTGGATATGAGCATGGTAGGCACAGGTATGTC
CTTCACGAATGCAACCAACAAATTGATTGAGGAGAGTCCGGAGATCATTGACCGCCTCAAACAATCTGTGCGGCGCATTGTCAAGACGAAGCTGAAGCTC
GGCCTCTATGACAACCCGATGCCTGGCGCGGAGTACGTTGACATGGTTGGTAGCGATGATGACGTCGCCGCCGCGTTATCTGGAGCTCGCGAGTCGATCG
TATTGCTGCAGAACAATGACAGCACCCTGCCTCTTTTGAAGAACGCATCAGTATTTCTGACGGGCCCCAGCGCACACAACATCGGATACCAGTGCGGTGG
CTGGAGTCTCCAGGTATGGGGAGTATCCGGTAACGACATGTTCTCCACGGTGTTTCGGTGAAGCAGGGCTTCGAGGTAATTGCTGCAACGATTCGTTCAC
TTACTTCAACGGCCTGAATATAACTGGTAACTACACGGATGTGGATCTGGCGACTGCGAAGGAATACGCCAGCCAAGCCGAATATACGATCGCAGTCATT
GGCGAGGAGCCGTACGAGGAGAAGTCGGGCGATATCGACGATCTCTCGCTGCCTGCTGGTCAAATTGAGTACGTGAAGGAGCTGGCATCGACGGGAACTA
AGGTCATCGTGGTGCTGTTTGAGGGCCGTCCGCGTCTGCTGGGTGACCTGCCGGAGAACGTGTACGCCATCCTGAACGGCATGCTGGCGTGTGAGCTGGG
TGGCCAGGCCGTAGCTGAGATCGTCTACGGTGATGTGAACCCGAGTGGCCGTATGCCTATCACGTATCCCAAGGACTCTGGCAACGTCATGATCCCGTAC
CGGCACCGCGTGACCACGCAGTGTGCGACGGGCGACTACTGCGAGCCACAGTGGACTTTTGGCCACGGTCTCAGCTACACCGACTTCACGTACTC