Description :
From Genome Similarity Track
Location :
Scaffold_92:24817- 26317
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_92-fgenesh-gene-0.326S protease regulatory subunit S10B

Sequence
1500 bases(100 bases per row)
GAAGAAGAGAAGTGAGCGATCATGTCGGCGTCCACGACGGAGGAAGAGCGCGCGCAGGTGCTGAGCGCCTACAAGGCCAAGGTGCGCGAGCACAGAGAGA
TGGAATCTAGGTGCGTTGTCTTTGTGCTTTTATATACGTGGCTCTACGTGCATCTGCTGTGAGTGGTGGGCAGAATGGAAGCAGGAAGACGGATCTTTTG
GATCTTTTCGCGTTGTCAAGCGTTCTTCATACTAATAATCTCTCTTCTACCTATGAACATGTGCACGCGTGTGTGGGCTCTGCATACAACTATATATGGG
TGCGCAGAGTCAAGAACATGCGTGAGAACGTCAAGGCACTTGTGCGTGAATACAACAAGACGGAGGACGACTTGAAGGCGCTGCAGGTGCGTTCCGCATG
CGCAGTTACCAATGGAACTATGTGTAAATTCATAGACTGATCCGATACCCTCTGCACTTGTTGCTGTGGTTATCATCTTGCAGAGTGTGGGTCAGATCAT
CGGCGAAGTGCTGCGTCAGCTGGACGACGACCGCTTCATTGTGAAGGCGTCGAGCGGACCGCGCTACGTGGTCGGCTGCCGCTCAAAAGTGGACAAGACG
AAGCTCAAGGCGGGCACGCGTGTTGCGCTCGACATGACGACGCTCACAATCATGCGCTACTTGCCGCGCGAGGTCGACCCGACGGTGTACCACATGCTCA
ACGAAGACGCCGGCAACGTGTCGTTCTCAAGCATCGGTGGACTCAATGAACAGATCCGCGAGCTGCGCGAAGTAGTGGAGCTGCCGCTGACGAACCCGGA
GCTGTTCCTGCGCGTAGGCATCAAGCCACCAAAGGGCGTGCTTCTGTACGGACCTCCTGGCACAGGCAAGACGCTCTTGGCGCGTGCGCTCGCGTGCAAC
ATCAACGCCACGTTCCTCAAAGTGGTCGCGAGTGCAATTGTGGACAAGTACATTGGTGAGAGTGCGCGTGTGATCCGCGAGATGTTTGGCTACGCACGCG
ACCACCAGCCGTGCGTGATCTTCATGGACGAAATCGATGCGATCGGTGGCAGCCGATTTTCGGAAGGCACGTCGGCGGATCGCGAGATCCAGCGTACGCT
CATGGAGCTCTTGAACCAGCTGGATGGTTTCGACGCACTCGGGCAAGTGAAGATGGTGATGGCGACGAATCGACCGGACATCCTGGATCCTGCGCTGCTG
CGTCCTGGCCGTCTGGACCGAAAGATTGAGATCCCGCTGCCAAACGAAGCCTCGCGCATGGACATCCTCAAGATCCACTCGGGTCCGATCACAAAGAAGG
GCGAGATCGACTACGAGTCGATCGTGAAGCTCACGGACGGCTTCAACGGCGCTGATATCCGAAATGTGTGCACAGAGGCCGGCGTATTTGCGATCCGCGC
TGAGCGCGACTACGTGCTGGAAGAGGATTTCATGAAGGCGGCGCGCAAGCTGGGCGAGACGAAGAAGCTCGAATCCAAGATGGACTACAGCAAGGTCTAA