Description :
From Genome Similarity Track
Location :
Scaffold_41:24816- 26093
Transcript NameFunction/comments
Albla_Nc14039880protein kinase putative

Sequence
1277 bases(100 bases per row)
TTACCTTTCAGCTTTTTCTCCCTTGCGTTCAATTCGGCTTCTTGTCGTCTGAGGTTCTCTTCGACGCCGAGCAGTTCCTTCATTTTGGTGTTGTATGTGG
CCTGAAGCTGCTTGACATCGGGTGCGTTAGCAGCCGGTGTTGATGGTGTTGCCGGCAGAGCCGATGACGAGGATGAAAACGACTGAAACACGGCGGGATT
GGCAGCTGCATATGCACGCAATCGCTGCTGTAATTCTGGTATCCTCTCGAGATCTTCTATCCTTGGTCGCCGAGAGCGCTGACGATGCAATTGCCAGCGA
ATTGCTTGAAAAAGTCCTTCTGTATAACGACTTGAGATTGGTGCAAAACGACCAGCGTTGATCTTTTTAGCCAATGCAAGTTGATTGGTTGCATCGAACG
GCGGTCTATAGAAATGAAAAACGATTTAGAATCTCACTTGTGCACGTGAACTGCGAGCTGTACGTACGCTAAGGTCGCCATTTCGTACAATAAGCAGCCC
AATGCCCATATATCCGATCGGTCGTCATATGTCATCTCATTCACCATTTCTGGACTCATGTAATACGGAGTTCCCACGTTTGTTTGAGCAAATCTTGACT
CGCTTTTAAGCTCTTTTGCTAGACCAAAATCGCCCAGTTTTGCGTTACCCTAGGACACGACACATTGAATGATGCACTCGAAACCTCATTTCAGGTGACT
TACATTACTATCTAAAAAGATGTTTCCAGGCTTGATATCTCTGTGTAAGATGGGCCGCACGACATTCCCTTCTCGATGACGATGACACTCGCGAAGTGCC
AAGTATATATGTGTAAATACGTGCCATATGAAATCCTCTTCGATAAACGAGCTGCAGGTAACGTTAAGTGCGGATTCTTTCTATGATTGGCGATAGAACG
TACCCTTCACGCTTTTTCCGCTTAATAAATTGACTTAGATCTCCTCCTTCACAGTATTCCATAACGATATAAATCTTCATGGCTTGTTTGTCGATGACAC
GGTCCAAATATCGTACAATGTGAGGATGTCGGAGCTCACGCAGAATGTTCACTTCGCTCACAATCAACTGTTTTTCTTTCTCACTCATGGCACCATAATT
GACTTCTTTCCATACTAACACCTACAGTCACAATCACATGCGATAAATACACAACACTATAACGGTTAAATTTTGTGACGTACCTTGCCGTCTGATTTTC
GTATAATTTCTGTCACCACACCAAAAGATCCCTTCCCTATCACACGGACTTGTTCGTACGCTTCCATATCCGTCGCT