Description :
From Genome Similarity Track
Location :
Scaffold_32:248137- 250652
Sequence
2515 bases(100 bases per row)
AGAGATACGTAACCTCTCGAAGATGACGTGGGATCTGTTCCTGTCCGAACTAATGGAAGGAAAGATCTACGAGATAGTCTCACCAGTTTCAAAGTAGAAC
TTGGTAGACTGTTGCTCTTCGTTCGCAATGTACGAGAGTGTCTTGGAGATCGACAAGACAAAACGATTCGCTTCTCAAGGCTGGGACACCTTGAAAAGCA
GTCCATTTTACGAAGTTCTTTGGAATCACCGTAGTTTCTTTCCTACAGAAGTGCCGAACCGCCTGCCGGCCGATAGGGAAATCCGGCACGAGATTGACTT
GGAACCTGGCACCAAGTATAGTGTGACCAGGAAGTGGCCTTTTCCGAAGGAGCAGGTCGATTACATCGACCAGTTCTTCGACAAGAGGGCCAAGGCGGGA
AATGTACGTGAGAGAAAATTGCCTCAATACAGCCCGACCTTTTGTGTGCGTAAGGCAACAGGTGGTAGGCGCGTAGTTCATGCTTACAATAAGTTAAATA
CGGCCACCATACCAGCATAAACTGATCCCGCGGAAAGATGTCCAATTTAAATCAATGGGGAAGTCAACTATCTTTTCCGCGTTGGATTTAAAGGATGACT
ACTATCAGGTACTCATGAATGAGACCGATGTCGCCAAGACGGTGGTTAGCACCCCAAGCGGTATGCTATGGGAGTGGCTAGTGATGCCGCAAGGGTTGAA
AAACGCACCAGCGACATTCAACTGGGTGGTCGCTCATGTGATGCGTCCGCACCGTGCCTACGCGCCTCATTACTTTTACGATGTATTCGTTCATGGTAGT
GCCGAGGACGAATTGGGTGAGATAGAATTGCACAAACGTCATTTCGACGTTGTGTTGCAGACTCTGGGCGACGCCCAATTTTACGTCAACTTGCAGAAGT
GCGTCACAGGGGTCCCCGAAATACCTGTACTGGGCTGCATCGTGGATAAAAACGGTGTTAGAGCGGACCCAGAGAAGGTTAAAGCTATTAAGGAATGTCC
AGTCCCACGCATTGTGAAGGATCTATGTCAATTCCTTGGGCTTGCTAATTACTTGCACAAATATAGCAAGAATTATGAAGATCGAACAAACCAATGGATG
ACCTCCTGAAAAGGACGCAGAATGGACTATGTTCTGAGGCTCAAGTAGACGCTTTCACTTCAGTAAAGCAGTCACTTGTAGAGGCTCCGGTATTGGCTTT
GTCAGACGCGGATAATCCCTTAAGTGTTGTCTGCAATGCGATTAATTTCGCTATTGGCAGTGCACTTATGCAAAAGGACGATGACGGTATTGACCGTGTC
ATTTCGTATCAGTCCTGACTTTTAAGAGCCGCAGAGCTGAAATACCCCGTGCACGGCAAGGATCTATTTCTATAAAGTATGCTCTTGTTAAGTTTCGAGT
GCACTTAATGGGCACCGAAACTTTTGTAGTTACACGGATCACGCATCATTGCGGACCGCGATAAACCGCCGCACCTATCACCTAGAATGGCGAGGTGGCT
CACATTCTTCTCAGAATTTAATTTTCGAGTTGAATACAAGCTGGGGTAGTCGAATGTCTTGGCTGACGCATTATCGCGCAGACCAGACTTCAAGGTACGA
CACCTTGAAGACGTGTCTCGTGCTAAAGCACGAAGCGAGTCGTCAACACTGGCAGCCCCACGGGTTGACCATGTGCAAAACACTCCGGCCCTCTGATATA
AAGGAGAGCTACATGCAAAACGAACATTGTCGTCTGCTTGTAGATCACTTCGTTGGATGAAAAGTTAATGTTCCGTCGCACCTCAAGGCGATGATTAACC
GCTTTAGTTATAGTGATGGCCTGTTATGGCATCAATTATCACCTTGTGATCCATTGAGAATCTATGTCCCCCATGACACAGATCTCAAACAGAAGATTCT
CTACGACTTCCATGATGCACCATCAAGTGGTCATCTGGGCCGTGAGAAGACATTCTTACTATTGTCAGATGAATTTTGTGGCCACACCTATACAGGTGGG
TAGCCAGTTATGTTCGATCATGCGAAGAGTGTCATTGCGTAAAGCCTGTACCTTCTAGTAGTGCGCACTGAAGCCACTACTGATACCAACTGATGGTTGG
AAGTCGTTCAGTTTGGACTTCATGTCTGGAATGCCGCCTGACCATAAAGGCAGGACTGGTATCGTCGTCTTCGTTGATAGGTTGAGCAAAATGGTGCATT
TAGCACCGTGTAGCACCAAGGTCTCAGGCAAGGAGACAGCCTTCTTGTTCCTGGATCACGTGTATCGTATACATGGGATGCCCAAGTCCATAGTTTCGGA
CCGGGATCCACGTTTTACGTCAGCATTTTGGCGCCATGCGTTTGAGCTGCCTGGTAGCAAGCTCCACATGTCTACCACCAATCACCCCTAACCGATGGCC
AGACCGAAAGGGCCAATCGTGTTGTGGCGGATGTATTGCGCACAATAGCAACTCCCAAGGAATGGAGAAAACATTTGCCATTCGTGGAATTTACTATTAA
CAGCAGTGTTCACGC