Description :
From Genome Similarity Track
Location :
Scaffold_43:24813- 28847
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_43-snap-gene-0.56Gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_43-snap-gene-0.39Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_43-snap-gene-0.40Conserved gene of unknown function

Sequence
4034 bases(100 bases per row)
CCATTCACTTCAGCCACCACCTTCGTGTTGTACTGAACGAGGAGTTCGACGCCGTCGGCgCGCACAATACTCCGTGTTCGAAGACCACCTTTCGctACGG
CGACCTTCTGGCCGTCAGCATGGCGCTGGGCCGCTAGATTCACGCCAACGTCGATGCAGACATCGggcATccccggcTTCGTGATCACTGTATGggaTCG
CGAGGCCGTCGAGAAGATACGCGTGCCGTCTTCATGATAGGCCAcaCGCGACCcGTCCGTATGcGTGACAACCACGACGCCGCTCtCCCTCCGcAtCTCt
ACGACAGCATtCGTCTCAGGGTCTACAATCAACTCGCGgTCCTCGCCGTCTCCATTCGGAGGGACCTCTGCGCCTCCATTGGTGAAGACATCTCCACTTG
GGAGCATGATCGTCCGCTTTCCATCATTGTagACGCGAACGACAGCGCCTTTGCCCGAGACCACTCGATGCGTTTCTCCGTCCGCAtcACTTTCAATGCC
AAGCCGCTGCAGAACGATTGTACCATtcGAACTGGCGGTCACAACCAAGCCATCCTGTAGAGTCATAGTCGTCGAGATCGACGAGAACCCATCAGGCTTC
TTCGGCTGAGCTCGTCCGTCGTGAATGAGCAGCACGGATCCATCCCTGAAGTTGGCATAGAAGCGCATCGCGAATGTCCTGTTCTCGGTTCCgTtGTTTG
GTCGAAGTCCGAAGACATCCCTGCGAAGAGAAACGTTAGACGGAAGCtCAACGCCCTTCACGTCGACAAAGAGCATTACCCGTCCAGCGAGACAGTGAGC
CAAGCGGCTGCGTGAGGCGTTTGGtATAGCTTGATGGCACTTTGGTCAGCTGGGTAAGCGATAGAGCACTTCTCCGTCACCGAACCGAGTTCTCCGGACG
ACAGAGCGACACACGCAGTAGATGCGAGTGCTGTGCGTGGCGTGAGGTATtCATCGGCAATCATTGACTCCGGGTGCCAGTCTTTCAATGCCGGGCGGTG
ACGGACGTGCTCACGCGCAGTCCACGAAGTGACACGGAATCGACCAGGAGCCGTTGTGTTGACTACCGCGAGAAGAAGCGAATCAGTCGGCTCGTAATAG
TCCTTAATGAGTGTCGAACTATCGCCTAGTGTCATTGCGAGGCGTTGAGGCAAGACGTCGGAACTCAAGGGCTCGACaCAGTCCCGTGAACGCAGTTTGC
CAGACCAGGCGTGGCcCATGAGTTCCTCAAATCGAAGGAGTTGACGAACGAagTgCACCCGAGTGCTCGGAATCGACGAAAACATTGCGTATTCAGTGTC
CTGCACACTGCGCTGGGCATCGCTGAGGCGTGCTCGCACTGGCATGGCTTTCCTGCCGTTGTTGCTGACTCCCGGAAGATCGCAAGCTTTCCACAATGCC
TTCTCCAAGCGATCGATTCGCGATCCTCGGATACAAAACCTGGAAGCGGCcGATGAACCATGTTGGCCGACAAACGCGTCGACCGATCGAAGGAATCGTA
TCGCTGCGTCGTCGCCATGTTCGACAAATGCATCGGGCGGAAAGTGCTCGCATTCGTCCTCAGCCTCGGCACGATCTTCACCcTCAAGAgACCAGACTGT
CGCCTCTCGAAGAGCGATAGCAACAGCTGCGGCGCCGTTGCATGGCATGTGAAGATCGCGGAGGATCTCATTGTAACACGCTAGAGTCTTCTTGGCCTCT
TCACTTTCGGTATCGCAGTGAGGAATCGCCATGGTCCTGACGGACGACACCCAGTTCTTGAACGCCACCTTCTTTGAGACCAACGGCTTCATTACGTTGA
CGAGATCGCCCATCAGTTCCGGCCCAGTCTTggaCTCGTCGCtaGGAGGaGCTGTGCAAGGCACGTCGATAAAcACGCAGTCGCTCCATTCCAAACCTCC
AAtGTTGGCGTGCTGGTAGATATCGCGGaCAAACGGACTCGCTGTTTCAAAcACTGATGCAGgCGGCACAGTtCTTTCGACTGCAGcATCGATCCcTTCC
GTCGacACGCGCCTCGCCACACTGCGTCGCCGCTCGTCCgTTTGGGACAGACTCTTCCGTCGATtgCGCaGCTCCCGCATCGGATCGGACACCAGCACAA
CTCCATCGAGAAGAGGAaGGAGGGGGATCCCAGGAGACGATTGACGTGGCTCGTGGTGGCCTGGCGCATCTGTcAGTAATAGCGCACGGACTTCTGGGAT
GGTCGACGGGTAGTCCACCAGGAGATAAATGCGTGAGAGCGAGTcctcGTTCaGAGAGTTCTTCTCGTCCATACTACTGCCTTCACTAGGGGTCGCATTC
AAGCACTCTGTCTTGTCGATCGTCACGAGTCGGTGGAAGCCCTCCGCCAGAGTGTCTGGTGTAAgcaGCACTTCCCCTGCATCCAGCTCCTCCTCATTCT
CAGTAGCCACGATCGCAGGGGCGAGCGTTACTCCTGCCTCGCCGTCCGAAGCAGCGTTCTCCGCCGCcGCGTGAGCCAACGCCGCTGCTCGCTCTAACCG
AAGgTTATCCAGGCGTATTGATCGCACTGACTCCTCCACGTCCCGGCGCCGTATCACTCTGTAGGGCCCCGAAGGCTCTCCTGCGATCGCCGTCACAATG
TCATTGCGGCTCGCTGTCTCGATAGGCGTTTGTCCGCACGCGAAGATGAACACATGGAAGCTCCAGCCACGCTACAGATCaTGGCCATTGCACACGTCAG
TCGCTGTCAGTGGCTCTGTCACCACGCGCAGACCTTACCGAGCCATGCGCATGAGTAaCCATCTCGTTCTCGTGTCTCTTCATGATCTCCTCTACGCGGG
ACAGTGTCTTGTATCATACAACAGGGGAATCCCGATGCCTTTTCGGAGGGATCAAGAGTtGAATATCACTCAGCAAAGGTAAACGGATGACATTACGGAG
GTGtGGGCGCAAGACTTCAATGATCTGACTGATCATGGGCGtCTGGACGGCCcAcACGATGgACATGAGCCGCCAGTGGCGCGCTCCaTGCGACGAGAAT
GCGCTGCTgCGGGgCGCACGGGCGGTGCTAACTAGTCACTACGATCTAGATATCGGTGCCGTGGTCCCCGGGaGCGTGGAGCAGACGGgCTTCCAGTATA
TGGTGCGAGTTCGGAGCTTCATATTgAGACgCACGGGATGgAGGGgCTGAcGCGCTTGTGGCCTAGAAAACGACTGACGCCCTGTTGgCGGCGCAAGCCA
TTGCACACAGCGACTTCAAGCAGGCTGTAGCACAGTTCCGGTGAGGACGTGAGGCGTTAGGGACGCTATAGGCGGAATGGAATTGACGGTGGTGCTGTTG
ACAGTCGAATCCTCTCGTACCAGCGACCCGAAGGTGGCCTCCCGTTTCTCGTCTACGGGCCGTCTGTAAACGCCTCACAGCGGTGGATCGACAGCTCAAA
GACGTTCTACCCAGGTCCTGCGTTTTGGAAGAACAGCGACGGCAGTGTCAACACCAATGGCTCCACGAAGGCACTGCCAAGcGTTCCGATCCTCGCCCCT
CCTATCGCTGCGGATGTTGCATGGCAGATGTATCGAGTATCGCCGTACGAGACTGCGATGGGAGTCGTTGGTCACAGTGTCGAAGCCGTCCAGTTCCTGT
GTGATGTCTACTCGCCGTTGAAACAGCTACACAGTCGgCTTTTCCACCCATCCCAACGGACTTCTAACTCctCGCTCCTCTCcGTCAAGGTGAGACTCGc
ATCAGCTCATGCACGTGGGTATTAGGCTCATAATTCTACTTAAGCATCCATGGGAAACCATGTCACCATTCGGGGCGCATTGGGGAGATCATTTACAGCG
TGTCAAGTCGATGGAAGGATACGACGCATTCATTCGCACGATTCCCGAGTCGAGCAAAGTTCGCTTTGCTAGTGGGgCTGTGTTGAATGGAGAGGCAACG
AATGCGGTGGCAGATGTCTTCGAGCCGATGATGTTTCTCGCGTCATGTTACAATGCATCCCTTAGCTCGAGCGAAGACCATTGCGCACTTGATATTCACG
ATGTCGAGTTCAATACGCTCGCTCTGCGGTCTGC