Description :
From Genome Similarity Track
Location :
Scaffold_1:2481167- 2492338
Transcript NameFunction/comments
Phyin_T30-4PITG_00473Tetratricopeptide repeat protein%2C putative
Phyin_T30-4PITG_00474Histone-lysine N-methyltransferase%2C putative
Phyin_T30-4PITG_00475Putative uncharacterized protein
Phyin_T30-4PITG_00476Putative uncharacterized protein

Sequence
11171 bases(100 bases per row)
GATTCGTAATCAAGACAACTTCTGGTCACTGGAGCTCATCACTTTCAAATCGAAGCAATGGCGAACACAGACGACCTAATGCAGGAGCTGTGCGGCGTGA
GCGTGTCTGACATCGACACCACGCAGAATGCTGCACGGCAACTGCTGGACCATTATTTGCTCGCAACCGAGCGCGCAGTGCTGCAGAGTAACGCCAAGAA
CGTGATCGAGGCTCAGCAGGCTCTCAAGGATGACAGCGAGATGGCTCCAGTTTTGGCAATGGCAAAACTCATTTGCGAGGGCGAGTACGCGGACGTAATT
CGTTTGCAAGATGCACAGAAGATACTACGGTCTGTGGCGCAATTGCGGAGCAAAGAAAAGGACAACGAAGACGAGGACGCTCACATTTGCGGCTGTATCG
CGTCGGCACTTCAGAGCTACTTATTAGACCAATGTGACAGCGCTGAGAGCCGCCTCGTGACTGCCTACCAGATTATGTTCGTCGGTGTCGCCTTCTTCGA
CATGTACGTGCAGGCCAATTATACAGGACCGGCATTTGAGAAGGAGACGCTGCGTGACGTGCTCGATCTGGCCACTCGCCTCGTGTCTTCCACAGCTGAC
AGCAACGATAAGAAGGCGCACAGCGATGCGCTCGTGGCGCTGCAGGTGGACGGTGAGAGTCCATTTTCCATCTGCGAGTATCCACAGTTCCTGCTCATCG
GGCGCTGCTTGCTGGACTTCGTGGGCAACCACGCGTACAATGATTGGTCCGTGGCTGCCAACGAGGTTGTAAGCGGCCAAAACGACAACGAAGTGTCGGA
TGATATTGTCGAAGGACCTGCTAGACGCCAAATTACTGGTGGAGCCGCTATCCGTGCGCTTGGCGAGATGTTAGAGGAGATAAAGTCAGCTGCGTGGTGG
AATGCTCGTGCTGCTGTGGCACACGAACGTCTGCTGCTCGCTAGACAGCCATCGAACACGCTGTGGTTTGAAGCTCGTCGTGGATATATCCAGACGTTGA
AGACCACCCAGCTTTTCGCCTTTGAGAAGGATACTCAATACCTGCTCGCTCGCGCGTACGTGGAGTGGGGTCTAGCTCAGCACTACTTTGACAAGAACAA
GCACGGCAAAGCTACGTTCGCCCGTGCAAAGGAGATTTCTGGTGTGAGCGTGCAACTCAGCGGATCCTTGGGTAAACGCACCAAGTTCCAACAGAAGAGT
GTGGCTCAGATGGTATTGCTGGCAGCATCGAAGAAAGAGCCTGCGAGTGAGGATGAAGACGCCTCCGTCTACGCCACAGCTGTGGCTGAATCGACTCACG
TGGACTTTGGCGGTAAGCAGGTCACGACAGAAGGTGAAAACGCTGTTTCGCCTGCAGACGGCCTCACGGCCGAGGAAGAGCATATCCAGAAGCTTGTACA
AGAAGGTGAGGCTTCTTACCGCAACGTGAATTTGGACCAGGTGGACCAAGACAATTATCTTCTGGAAAGCGTTGCATTCGAAGACCGTAAGCTCACGCAG
CAGGGAAATTTGCAGATCGTTGACCAGATTGTGTTGTTGGGATTATGTCTGGACGTTAAGAACAGCAATGCCAACGATGGTTTGACCCGCGAGGAGATGA
TGCCGTACGTCACTCGTGTACTTGAGAACCCCAACAACTGGATGGTATACTCCACGGCACTACTGGAGCGAGCGTGGCTGGAATGCGAAAGCTCAAAGCG
TCGTGAACGCGCCGTGTTGCAGATGCAAGCGCTGGTAGACCAGCACACTACACGCCTTACGATCACACAGAACACGCTCCAGTCTATCGCCGACTCGGCC
CCAGCTCGTGAACGTATGCAGTTTGTGTATTCATTGGCTTTCCCTCCACGATATGCACTTAAGCGTGATCTGGCCGAGCGTTACTTCAAGCTTGGGGTTC
TAGGCAGTGCTGTTGAAATCTGCGAAGAACTCGAGATGTGGGATGACGTCGTCAAGTGCTACCAGCTCTTGGACAAGCCGATGCGTGCAGAAAAACTTGT
ACGTGACCGTCTGGAGATTGCGCCCACGCCGTTCATGTGGGTCACGCTCGGAGATCTCACCCAGGAGCCCTCACACTACGAGACGTCCTGGATACTCTCC
AAGCAGCGCTTCGCTCGTGCCAAGCGTTCACTTGGTCGCTACTACTTCGAGAAGGGAGACCATGAAGCGGCTATTCCTCATTACGAGGATGCAGTGCGTG
TGGGTCCCATGCACACTGGCGCTTGGTTCACTCTTGGTGCGATCTCAATGCGCATCCACCGCTGGGCACTTGCTATGCGTGCGTACACACGCGTTGTCCA
ACTTGAACCGGACAATGGTGAAGCGTGGGGCAACTTGGGCTCTATCCACTTGCATAATCAACGTTACGCAGAGGCCTTTGCGGTGCTGGAAGAAGCTCTG
AAGCAGAAGCGTCATATGTGGCAGATGTGGGAGAACTACGCTCTGTGTGCGATGGAGACCAAACGCTACGGCGAAGCAATGTATGCAATGCACCAGCTTC
TGGACATGCGTGCCAAGCACAAACGCCCTGTGGACAGCGAAATGCTAGCGTGGCTTGTAGAAGCCATCGTGTATCCAGAGTCATTGAAAAAAATGCAGTA
TGAGGCTGATACCGAAGCTGGAGTCATTCAAAAGGCCTCCTCGGACGATGAGGAGGATATTGACCCCACTAGTGAGGATGAAGACTTGGCAGAGCTTGAT
GAGGCAGCGACAGCCACCGATGCGACACCCCCGCGGTCCGACTCGCACCACAAAAAGCAACTGGCGATGCTCTTCGGCCGCGTGACGTCTATCGTGACGA
ACGACGCTAAGATTTGGCAAGTGTATGCGCACTTTAATGACGGCGTGGAAGGCCGTGCCGATAAAGCTCGTGACTGTCGACTCAAACAGTGTCGCGCACT
GCAAGTTGCGGGCTGGGAGCGCGAAGAGCAAAAGGTGGAGGATCTGTGTGCGGCCGCATCTAAATTGGCCGAGGACTATTTGGCTGAAGGCACCAAGAAG
GCCCTCTACTCGTGCCGTCTGTACATTCGCGGCGTGCTTAAGAAAGCACAAGTGGACTTTGCGGAGCTAGAAGCTGTAAAGACGCTCGCCGCCGCGCTGG
ACGAGGTAAATGCTCGGGAAGCGCAGCTCTAACTTTAGAGGCAACAGTTACCACAAGAGAAGGACATGTTGCCAACATGTCATGAATCATGAGCAACATC
ATGACTCATGATGTTGCTCATTTATCAGCAACACGACGTTAGATTTTCATCCAATCACTTTTTGAGTTTGGTTTGAAATCGACCAGCTCAATGAAGATGT
GCGTCTTCACATACAAACTTCAAGTCACGCGTTGCGCGGGCAATTTTGGCGCCCGTGATTCAGTCGCCAATCAACCACTTCGGTCTCAGCTACCAAATAC
AAAACTCTGTGGATAAATGCCTCCGAAGCAGGTTGCGCGGCGGGGCCCAGCCAAGAAGCGCAGACTTGAGGCCGTCAGCCCCATTGGCAAGCCTAAGAAA
GCCAAGCGCGGACCTGGCAAGAAGAATAATCCCGGTGTTGTCCTGACAAATGAGCCTGAACCCGAAGTCGAGCCGCAGAACCTGATGGAACCAGAGACGA
CGATCTTCCTGCAACTTTTGGAGGACGACGCGCGCAGTCTACCGCCACCACCACCGCCTCTCTCTAAGCGTCGTAGCTCGTCCAAATTATCTCTCGAAAA
GCACGTCGTGGAGTTCCAATTGCCCTTCAAGGAGGCAGAGATTAAGAGCCTCGAGGAGCGTCAATGGGTGCGCCGCCCACCACCGTTCGGCAAGATTAGT
CGCTGCGTCTACGTGTCCACGAAGATGCCCATTGCCGACTTCCCCGTACACGAATGCACGTGCTATGAAGAGACTCACAAGTCCATGACCAAGCGCACCA
CCATGATGGCCAGTGCCAAGGCTCAGAAGGACAAAGAGCAGCACGTAGACTCGGAAAACCAGCATGATATAGAGAGGATCGTGTACTGTGGAGAAGGGTG
CTACAACCGCATGCTGTTCATCAGTTGCTCGGATGAAACATGCTCCGCCCCGGACCCGAGTGTATGTAGCAACCGCGCAATTAAGAGGCGACAACTCAAG
TCCATGCGAGTGGAATATATCCCCGGCGGCCCTGGATTTGGGCTCATCACCAACGAGGACATCAACGCTGGAGAGTTCGTCATTGAATACGTCGGCGAAG
TCATCGATGACAAGGAGTGCGAGCGCAGGATGATCACGTACAGAGACAACGGCGAGGTGAGCGACATTCCCAGTGCTAGTGCTGGTATTAAAGCTAAAAC
TTTCTTATTGCTAGGTCAACTTCTACATGATGGAGCTGGAGAAGAACATTGTCATTGACGCAAAGTACCGCAGCAATGACTCGCGCTTCATCAATCACAG
TTGCGACCCCAACAGCGTTACCCAGAAATGGTTCGTTTATCACAAATATTGAACAGAACGCAGATGTAAAGACTGATCTGCTGGGCGTGCGTGTTGAAAC
CAGGAATGTGGACGGCATGCAGCGTATCGGGATTTTCGCGCGCCGCAACATTGCCCCCAACGAGGAGATTACCATCGACTATAACTTCTCACATTTCGGT
GAGGCTGCCGACTGCAGATGCGGATCCACTGCGTGTACAGGGAAGATGGGTCTCAAGCGGTCGAAGATGCCTGCGCTCGATCCTCGTGTGGTGGGTACTG
CGAAGGCAAAGAAGCAGACGCCAGTGGATGAGGAGCCACCCGAGCTAAAACGTCCCGTTCACTTGACGTCGTTGGCGCTGTTGAAAAGCTCGCAGATGCA
CGACAGTTGGTTGGATTATTACGGCTTCAAGAAGCGTCGACTGTTCCTCAGTCATCGACCTAGACGTCCCAAGAAAGAGGAAGGCGTAAATGTACATAAT
GGCGAGCTACGCCATACTCTACCGTCCAGTAGTCCAGCCTCCGTGTGCTCTACAACGACTGAAGAGGATGTATCACTCACACCGCCACAAGCAACTCACA
GTAAACCCGTCGAAAAGAAAACACGGAGGAGCAACTGGTACGAGAGGGTGATAGCGGGGGAACACCTGCCTGAAATGAGGGCTCTTCACAGCTACATTTG
CGGCGGTATATCTGACTGGACGATACACCTTGCTGCAGATTTCATGACCGAGGTCTCTTTGCCTTCACCGGTTCAAAGAGGACCTGATCACCCGTTTAAG
AAGCGTGTTCGTCCTAGAAAGGAGACGGCAATGCTACGTCAAGTAAGCGGGAGTAAACTCCTTCACAGACGACTAAGTCTCTCCCAAGCACGAGCTCGCT
GCATTGATGAACTTGCCGCGTTTGCAAAAGGCAAGTCGAAGTGGAACAAGCGCGTTTCGTCCTCCAGATCCATTGACCCAGACCGTATTTATCGCCTGAT
TGACCGTGTGGATGGCAAGCAGATCTTCGTTAACACTGATCAGGTAAGTCACAGCTCAAATCTACTGGTTCTACAGGGCAGAATTATTAACTATTGTGTG
TGTTAAACGTGCAGAACGACTTGAACGAAGATGCTTGCTTCCGCTGTGGCCTAGCAGGCGAGCTAATTTGCTGTGACGGCTGCCCCGCCGCCTTCCATCT
TAACTGTACCAACCTTGCTATGGTTCCTCCGGATGGAATCCCATGGTTTTGCTCCGAATGTACCAACCCGAAGCATCATCAGAAGACCTCGAAGACGTCT
CAAACAGCGGTCATCGCTGCTGGGGGGATTAGAAGCAGCGGTCGTACCACGCCAGCCGATTACTCTGGTCGTCATCTTCGCACGCATACAGCGCATCAGA
TTCCGAGTCTCAAGAAGATTTTTCATGTCCCGGCGGCGACCTCAACTAAGCGTCGCTATAAGAAGCGGCATAAAGCCACCGACCGATCATATCGCGAGCT
GGAACACATGCCACTCCCCGTGTGGAACGAGAGCGATGGTGATGCTGAGCAGTAAAAAAATTACTGCAACGAAATCACGCGATGGCCTTTTGTGCAGAAC
TGTTGATACTTGCACGACGCTGTAGCTTTGTCTTTAAGAAAATTGGCAGATACCTAGAAATGGATGAATAATAAAAGGCTTGTTTGTTGAAAGGGATGAA
AAGTACCGTGCAGCTCTCTATTGGTTGTAGAGTTTAGCTGGAACGGGGCCTTCCACGCGATCTTTTAGGAAGCCTTCACTGTCCTCCTTAGCTCGCTACA
GCGCATCAATGATAATACTGATTAAAATAATCTGTGCAAGAACTAGCTAGCTCTAGAGGTATTAAAATGTGCATACCTTGATGGCTGTGACGAGTGCAGC
AAACGGGCCCGTCGACTTAAGTTCAGGCATGGACTTGCCGCCGTCCATCTTGCCTGAGTATGAGTGATTGAGCTTCTCCTCTCCGGGTAGGGGCGCATAT
TCGTTGGAGGCATCAGCAGTAGTCGGGAAGCTTTCGAACGAGTGCACTACTTTGCCGTGGAACTTGTATGTCGCCCTCATGCCACTCATGTTGCCTTCCT
TCTGCAAAAGTCAAAAGACGCTTCGAATAGTTTGTGATATTAGATATGAGAGACCGGTCCTTACAAATTGATATTGTTGCCACATTCCAGTTTTGCCACA
ATGATGAACGCGTTCCTCGGAGAGTTGCGCATGGTAAAGGTGCTGCACCAGCAGTCGGGCGTGTGTTTATTTACGCACCAGTGGAAATGGAACCCGCAAG
CACATGCGGAGGGCGTGGATGCGCTCGTCATGTCCTTCACGCAGTTCGCGCGAGAGATCGATGGAGGAGGTGAGTTATTTAAATGAGTGTTGCATATTTC
CCTGCAATTCTAACTTATGTTAAATGTAACATAGAGGTTGTGCAAGTGCACTTCGACCCGAGCAGAAATGACAAGAAGGATCGATCTGGTAGCAGCCCAA
TGCCCGTAGGCAGCAACCAATCTTTCCTTAAAAGTATTAAATTTGCTCAAGCTTACTAACAAATGTCCGCACTGCGCAGACATCTTCCGGAGGCCTCGTG
ATGATATCGCTCCAGAATGAGGTCATCCAGGCAGTTTTATTCCATGATCGAACATCCGACGCAGCGTGCACCGCTCTCAAGTCTTTTCTACAACGAATTC
TTGAGCGTTTTTCAGAGGTATTCGCGCATGAGTTGGAGCAATTACAACCGCAATTGCAAGCGAGCGCCACACCTACCGCTGAAGAGGTTTGCCATTTTTA
TCTATGAAATTTTGAACCGAAATAATGTTGATGTGTTTTATCTCTCGTATTTTTTGCAGCGCGAAGCTGTTGAGGCTCCGTTTCGGAGATTTGAGGCCGA
GCTTGACAGCCAATTGCTGCTGCAACCTAATGGTGATCATGGCTTGCAGTGAGGTGGCAATATATCGAGCTTGTGTTTTACAGAATACATTACAAATCAT
CGCAGGCTTTGGCTACATTTACCGCCGTTTTACAAAGTAATCCCCAGTGTATAGAGTAAATAAGATGTATCGTTGTCGTCCTCTCTTGCAACTGCTAGTC
CAGCACACTCTTCCGGTGTCGCTCCCCCATTTCTACGGGTTTGTCTCCTGTGGTGAAGCCCCATAGTTCAACTTGGACGCAAGAAAACTCCTGCGAAGTG
GTTAATGGAGGCGAATTAAACGTCTCACACGCGCCACTTGTCCCTCGAGATAAATCGCTATCCTGAAAGACCGAAGAGCTCAAGTGTGTTAGTCATCGTT
TGTTACATTATAGCGAGTCAACTCTACTCACCAGGAACAAACCAAAGTTGCCGCCGCCCCCCATTATCAACGACTCGTCCGAGCACAGCATAAAGTAGCT
ATTCTTTCGACTCCATTGGTACTTAACAAATCCACCGGCAGCACTTGGGCTCGCGAACGAAAACAAGAACGATTCGCCAGTTCCATAGTAGTGGAAAGCG
TGGTGCCATTCATCCGAGGCATAGCCACCAAACACATTCCCTTGGGCGTCCTTGACCACCAATAACGTCGGACTCTGTTTCCTCGCTAGTATCAGCAACG
TCTCCAATGAGGATCCATTTGCTTCGACACTGTAAATTCGATACCATCGGCACAATTGGCTTGTGATCGGCAACGCATGGTCAATATACGCAAGATGCTC
AATCTCCAGTATGCTTGACGGGTCCATCAGCTTCGACTTGTAGTCGTCTGGATTGTAATCAAACGAGGGTTTCTTCTTGGAGTAGCGCAATGGGGGTGAC
AGTAGCGATTGATCAGCCAAAGCTGCAACCCGAAAGGCGTCATCATCGACCAGCTCTGCTTGCATTTCGAGAACTTCTTCGCCCTCATCGAGACGACGTG
TTCTTATCTCTTCCCATTCCACTTGTAGGTCGTTCACGGTAACGGGAGCTTTCTTCAGTAACTCATAAATTATTCCCTCTGTTTCTGTAATCACACGGGT
GAAGGATGCTGCCTTTGGATCCAGCTCACTCCAAAGTTGGTCGAACACTTGGAACATGAACATGAAGAGCTTACTGAAGTACATGTCTTCGTCAAACAAC
TCCCAGAACGGCTCCAGCGACATCGCTACAATGTCGATCTCCGGGTGTTTCGGGCTCAAGCTGTAGGTACAAGCAGCGAGCGTCAGTCACAGCACAAAAT
ATTTATCGCGTGAAAACTTACAACAGCTTCAAAAGCTTCACTAAGGACTCGCAAATGGACGACGCGACCAGTCCTGCGTCATAAGACGGCAACTCAGACG
GCAGTGCGCGCATCTCCAGCAGCGGTAAGGCACCTGGATCAGTCTTCAACCAGTACAAAACTGCTCGCAGCATCAATACGCCACCCTTCTCAAAGTTCCC
CAAGATAGTTGGCTTATTAAAGCCAAATTGCTCCCAGTTGCTCACGAGCTCCGGCTCTGTCGTTTCGCTGGTTGTGGGTGAAGACCCTCCACTGCTAGTA
GCACTAGTCGGTGGCGTCGCAGCTGTCGGTTGCCTCAAATCTAGCTCCAAGCTGGTGGTAGTATTAGATTGAATTTCAGATTCCAGATCTGTTGCATTGT
CTAATTTTGAGCTTTCTGTGACTTGCGAGTTGATAGAAACATCACCTCCTTCTAAGTGGTCACGAAATAATCGAGAAATCTCGTTCACTTGCTGCCTATC
GGACAAAAAGTTCATCAAGGGTTGGAGCTTCATCTGATGAGACACCATGCGAAGAGCTTCTTTCTTGGCTTCCAAGCGCTCAAGCGCATCAACCACTTGC
ACTCGTATGTCATGAAAAATGGTCGCGTAGTGTTCGATCATCCGCTCCACTACTTGCGCTCCAACTGCTGCATACCTCACGTCTTGATACTGAGAGTGCG
TTCTAGCACGCGAGCGCTCAGCCGACGAGCCAGAGTCCTTCTTGAATGCAATTACTGGAGCTAGAACAGAGGAAGCTGGAAAACATCAACGCCATTCTGC
TCACAATGCTCCGGTTGCTGTAAGAAATTCATCAAGTTGATAACCCTCTTCAATACGATCTGGCAATGCACTGGCAGGTCATTTACCAAGCACGTAATGT
TGCGCACGCTTGCGTCTTCATCGCGTAATTGACCAGCTGCCACGAACGCGTCGTATTTGTCATCGGTCACTATTGCGTCCGGCAGGTTCTTGAGGAAATC
TAAAAGCAAGGCGCCTGCACATTGAGGGTCCAGATCTTTCGGTACCGAGCCCTCTGTCTCCACAGTCTCTCGAAGCTGACTCAAGCGGATACTCAACACA
GTCGTTCGAAACAGTCGTGGGGTATCTGGGTTTTCTCTCAATATTGCAACGCAATCGTCCACAATGTTCGGCAGCGCTAGGAGTGGATCAATCAGAGCGT
AGCGACTGTGATATGGATTTTTCGAGAGGGATGCCAGACTGACACCAAACACGTACTGCCACGGTTTTATACCTTTGAGACGATGTGGGAAGAAGGCCGA
AGGTAGCTGGATAACTTCGTCCTCGTCGTCCTCCGTGACAGCCTCAGCTTCTTGCACTTCCAGGTCTTTTAAATCTTCAAGCTCGACTAGCACTGGTTCG
GCGTCTGGGGGTGGTAGAAATGACCCAGCTCTGGAAGGTGACACCCCCACTGCTGCAGCAATATCTGCATCTGTGATTGTAGACACCATTTCTCCGCTGT
TGCTTTCAGTACTAGGCTCAGGTTCCACTGATTCTGCTTGCTCTGACACATAAAATGGATCGCCGTTGACTTCAATGGCGAAATGCACCTCCCGGAGTGC
AATGATCAGCTCAAGAAACAGGCCCAGTCCTTCAGAGCAGCGAACAAGCGACCATTCTTCGTAATTGTTACGGATCAAGTGCTCGCAAGCCATTGAAAAG
ATCATCTAAAATATCACCCACAAAATTAGATGTCAACAGCTTGCAAGAGAACGAATGCATGCTCTCAGTACCCACCATAATACTGGACTCAATAGTGTGG
TTGTTTAGCGCAATCTTCAACCAGCAACGTGCTTTTCCTACGTCAGTCTGTCGGAACCACCACAAGGTTAATCCCCAATGCAGCTCAACCGTCAACATAC
AACCACACAAACCTCCGCCAGGAATGCTGCAGACAGCACACTCTGCACTAGCGTCGGCTCGTCCACGATGAGCGTACTGGCGTACAGCACATGCCAGTAA
CACAGCTGCTCCTCGTCAGTACGGGGTTTGAGCCCCAACACCAAGCATTCTTCCAATGCCACACCTGGCAACAAACAGCACTAAAACGTTTAGAATTACC
TCATTGTTACAAGGATTAACGTCGATAATAACGTACAGAGTTCGCCAACACAAGAATCGCGCTCCGTCAGCTGCTGACGTTGTTCGCGGTGCAGTGACGC
CACCGGTGTCCCCTCCTGTTGCCCGACAACAGGTTGCTGGTCGCCTGCTTCGTTCAAATCCGCTGCGTTTTCTTTGCGTAACACTGCCAGTGTGGCGTTC
TTAAGTCGTGTCTGTAGTTCAATGACACAATATTCTTAGATCTCCTATCTCTTCGACTACAACAGCTCCAGTTCGAGTACCAGTGCGTCGTATCGTTGTT
GCACAAAGGCATCGCTGGCGCCGCCTCTGTCCTCATTCCGCGTGGCCAGCCAATGCGAGATCTTGCTCAACATATCGATGCCTTGAGCAGCTCGAGAATT
GATGAGCTTCTCGTCTAAGTCCTTTAAATACCCCGGACAGTTTTATCGTCTATGATTGGCCAAAAATAGGC