Description :
From Genome Similarity Track
Location :
contig_26:248106- 249630
Transcript NameFunction/comments
g6440.t1hypothetical protein

Sequence
1524 bases(100 bases per row)
TCTTCTTTGTCAGTGAAACTTGTGCGCATTTCTGCTAATTCTTGTATGTGAAATGAAGTCAGCATGTAGTGCATTTGACTTACCTTATGTATGGCGATGT
GACTGGCTGCACGGTGATACTGGTGCTCATTGTTTTTGCAGCGCTTGGTCGATGACGCGGCGGTGCGGCTGCGGCCGATTACGGCGGCTGAAGCAATAAA
ATACACCTCGGAGACACGAGCATTTGAAAAATACCCCCATCCTTCTTAAACAAAATGCTGTGATTGGTAGTAATATTACACGGTAGGTCGAGCACGGGAT
CAGGCTAAAAGGGCGCAAAAATCGCCCTTTTAGAAGTCCATTTGTCACCGTGTTTTGGAAACAGCGTTAAAGGGCGAGAAATGCGCCCTTGCACCGCGAA
AGGGTTAAATTATTGACTGGTTCAGAGACCAGGCGATTCGAGTCTTTTGTTGTTCACGAGGACGTTTTTTTTTTTTCGGGAGTTCTTTGCCCATGTGGCT
TCTTTTAATCCAATCAAAATGATTTATTTTTTATGCCGAGTTTATCAGTCGGATGCAGTACTTGTACTATACTATAGCGGATGGCGTTCAGCAGCGTCGG
CTTTTTTAGTCGTTGTCTGTACCTGATCAATACCTAGACGGAGTTGGGTTACAGGCTGTGTGACGCAACTTCAATCTGCATGGGCTTGAACCTGTTGCAA
TGTTGTACCTAGCAGTTCATTACCTATTTGCCGACGTTAACGAGCCGCAAGAGTGCCTTGAGTGCTTAGGCAAGACGCCATTGTGATGGTTGTTCCAGGA
TGGCATCAGCAAGGACCGGGTGCGATCGTTCGTCGTGCAACATGTCTGTCAAAGCTGACTCAGCGTATTTCTAAGCGCATGAAAAGGAAGCATCGAACGG
CGATTTCAGATTTCTGTGTAGGAAGAGATGGATGCGACACAGCACGCTCAAAGCAGCAGCTTTCAAAGGCATTGCATAGATTCATGAGTGCTCTGACTGA
CCTTAGTTAAATGCATACAATACGGCGCTCATAATACTAAGAATTTGAAAGTGCCTTTCATACAGGCAGTAGGCATGAAAGCGTGGATCGATCATAAAGA
AATTTCAGTACGCATACAGTCTCAGAACGGGTAGGTATTATTATAGAAGAGCAATGAGCCGGAGACTAAAACGAGCAAACCCGGACGGCATTTGCGGAGG
CGAGCCCTTTTCTAGCAAGCTGAACAATGCCTCGCCCCGAGTTTACAACCGTTTCTCTCGCAGGAGCGTAGCGAATGCCTTTGCGAAACGGAGCGAATCA
AAACCAAATACTGAAGTGTGTCCTCGGATGCACTTGATTCAACGACAGCTTTATACTAAGATTTTGTAGGATGTCTGAGACTGTATGCGTATCCATGAAT
CCACATCACCACAATAATCCCAGATGGAAGAAACGACTCGGCTTTGCAGGATACTTTGCAGTACATGTACGTACATGTAGGTTACCAGCATAGCGCTTAT
TAATGGATGTCCTTCTCTTCCGGG