Description :
From Genome Similarity Track
Location :
Scaffold_1136:2481- 4053
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_1136-fgenesh-gene-0.0Amino Acid/Auxin Permease (AAAP) Family

Sequence
1572 bases(100 bases per row)
CcTCCCCccTCATCTCCTCCCAGAGGAGTGGAGTCTCCATTCAGGCCTCTTCCTCCCAGCTCCCcGTTCCCCATTTGCCAAGTCACCACCTCCCCcACAA
GCGTCTCTCCTCCACCATGGGGTCCAACAAGTGGTTCACGTCCGAGGATCTCAAGATCGCCTTCAACCTCTTCTGCTGTGTGTATGGCATCGGTACACTC
GGCATGCCAGCCAACTTCTCCCGTGCAGGCCCACTGTTAGCTGTCATTGCCATGCTGTTCATGGCGTTCGCCAACGTGTACGCTTCGGTTGTGTGCTCCA
AGGTCATGCTGATTGCACCACGGTCTGTCAAGACCTTTGGTGATCTCGGCGAGTGGTGCATGGGAAAGACTGGCCGCTGGCTCGTGGTTATCTCGCAGAT
GGGAGTCTGCTTGCTTGTGCCGTGCGCGTTCCTCGTGCTAGGCGGCATTCTCCTCAGCAGCCTCTTCCCCGGCGCGTTCCAGGACAAGACATGGATCGTT
CTCATGGCTATCAGTGCGATCCcAGTGTGCGTGACGCCGACGATGAAGGAAGGCGCTGGAGCTGCGTTtGCGGGCTGCTTGGGCACGATCATCGCCGACG
TCATTGGCGTGGCGGTGCTGATGCATGGCATGAGCGGTCACCCGAGCGTGCCTTCCTCGAATGTGTCATTTGAGCAGGTTGCACTCACGTTTGGCAACTT
gTCGCTGGCTTATGGCGCTGGTATTGTGATCCCAGCGCTGCAACGTCAGCACAGTGAGCCATCTCGCATGCCTCGTGTCATCGGAGTCACGCTCACGTTC
ATCTCGGTACTgTTCCTCGTGTTGGCCAGCACTGGTTACTCGGCAGTGGGCTGTCAGATCTCGGGCAACCTTCTTTTCACGATCGTTGCCAACGCCGAGA
CGGGTCTCACCAAGCTTGGCTTCTCATCCGATCGTGGCGCTGTCGTGCTCGCGTACCTGTTCATGCAGCTTCACATCTCGATTGCCTTTGCCGTGATTCT
CCACCCAGCGTTCTACATCTTCGAGCGTATGTGCCTCGGTATGCACAAGAAGAAGCCTGATGACGTGGAGTGTCAAGCTTACGCCACGATTAGCACACCC
GCCATCGGTACCATGCAGGATGAAGTCCGTAAGAGCAAGAACTCGGTGGTGTCAATGGCAGACATCGAGAAGGAGCACGACAATGAGGAAGACGAGGCGg
CTGAGTACAAGGGATATGAGCTGCGTTACATTCCAATGCGCCTGTCTGTCATGGCATTGCTGGCACTTGCCTCAGTTCTtCTCAAGGACCATTTCCTTGA
CCTCACCGACTTTGTCGGTGCCTCAGCCATCTCGGTTAGCTGCATTACGCTGCCAATTGTGTTCTACTTCAAGAAGATGTGGACGTCCATCCCGATCTGG
GAAAAATGCGCTGGGGCGATTGTGATTGCCGTGTGTCTCGTGCTCGGCACCTACGTGACCATCAAGACAGGCAAGAACCTCTTTAACCCGGACCCAGCTG
ACCCGAACGCACCCAACTTCCCCTTCTGCCACGAAGAGTTCCAGTACAACGTCTActACAACGCCACTGCTG