Description :
From Genome Similarity Track
Location :
Scaffold_5:24805- 28289
Transcript NameFunction/comments
Phypl_g219conserved hypothetical protein
Phypl_g220hypothetical protein PHYSODRAFT_490699

Sequence
3484 bases(100 bases per row)
GGCGAGGCACCCTTCGCGTGGGAGTCCCTGGAGGTGTGGGGCGACACGGCGGCGCCCTTCGCCTccgccgctgtcgacgacCCGCTCTCCGCTGCCGGCG
CGCCGTCTCCGTTCCCTgcgagcgcgctgctcaacgccAAGCTCTCGCTCTGGCGCGGCCCGCTCCACCGCCTgcgcgtggacgccgtggtgAACTCGAC
GTGCGAGTCCATGCgcgagggcgacggcgctttcgacaagctgctgaaggccgCCGGGCCGGAGATCGGAGTCGAGTGCGACGCCACGGGGGCGTGCCGC
ACGGGGGCCGCCGTGCTCACGCGGGGCTGCCGACTGCCGGCCAAGTTCCTCCTGCACACGGTGGGGCCGCGCTACCTGCCCAAATACCACAATGCAGCGG
AGAACGCGCTGCACTCGTGCTATCGCAGCGTGCTGACGGTCGCCAGGgagaacgcgctgcgctcggTGGCTGTCGGGTGCATCTACACGCAGCGCAAGGG
CTATCCGAGAGAGGAGGCCGCCCACATTGCGGCGAGAACCGTGCGGCGCTATCTGGAGcactacagcgacgacttcgaccGGATTGTTCTAAGCGTGGAT
TCGGTGCACGATATGGATGTGTACGAGAGGGTGCTTCCGCTCTACTTCCCACGGACgatgaaggagcagcaggagtcgcagcagttgctggcgacACGAG
ATCTCGGTTCGTATCTGGCCGTGACGGAACCCACAAATTGTTGTCTCGGGTCATTACTGACAGTACGATTCGCGTGCAGGTGACAGCTTCGGCGAGCCGA
TCATCGCCGAGCGCAAGATCCGAATCGGCAACCTCAGTAGCTCGTCTTTCGTTGGCCTTGAGTGCCGCAGCAACCAGCACGATTTTGAGCACAATTGCGA
CGGAAACCAGTCCCAAGAGAGCTCTGCGTTGTCCGATGACGTCGCTATAGACTCTGAcaccgaagaagcagaaagcGATATTCAGGCGTTTCGGGCCATG
TCATCTGATCCCGATGCGGAACGCTTAGGTaggctgcagcgcctgcaggaggaacgccagcggcgagcggcggaggctgcaATCGAGGAGCAGAAACGGC
TCGAGAAGGCTACGGCCAGCACAGCAGAATGGGACTATGTCGCTGCACTTCAACGCGCGAAGAAGGAGGATCTCTCGGATCTGGAGACTCTCGGGTTCTG
TTATTGTGGTGGGTTGGATCTTGCTGGGCTGCCTGTCGTTGTCTACATCGCTGGAAAATTGCGCGTGGGTGAGCTGGATATGGAGCGTGTGCTGCTATTT
GTTCTGTtgacgctggagacgcagcgtGCGGCTCTCAATGCAGCCAGCTCGCAATTTAGTGTACTCTTCGTGCACTCGGACGTGACAAACGATAACCAGC
CGCCTACTGCCTGGCTCAAGCGACTATTTCGTGTGTTTACTGCGGTGGCAGCACACCGCGCTCCAAGCGATCGACCCCTGCATAATAAAGGGGCCGACTC
CGTGCTTCGCTTTTTCTACGTGTTGGAACCATCCTTCGGACTCAAgttccagttgctgctgtcaaaGGGATactgcgacggcggcggatTCTACCGTCAA
GTTGTGTATCTGCAACATTCCGAGATGTTAGATAGCATTGCTCCAACTCTCCAACTACCACCACACATTTTCTCGTACGTGTGAGCAGGTAGCTCTCCTC
ATTCTATCAGTTTGATGTCTAATgctctgttgctgctggtttgAACAGGCCCAAAGAGAGTGCCTTCATGTTCAGCAACACCACTCCAGAAAACGTATCA
CCTTAACTACCATGTGCCTGGCACCTTCCCGTTTTAAGTGCTTGTGCGGCGTGTCATTATCTTTTGTGCAAGTGTGCCTACTGCTTCCACTTCGATGCAT
TCTGCACGATCACCACGGACTGAGCGTCAGATCCTGCAACGAGCGTATCGGACTCAGCGTGAACCGCCAGCGCGTTCCACGGCTGGGATCCTGAGGTGAG
TGGCTGTACCTGAAGGCCACTCGGACCCTTGGACAAGCCGTTGGAAGCACCCAGCGAACCGAACGGGGTCAGAGTCTGACTAGCTGCAGATCCACTGTAA
CGCTCGTACTCGACCGGGTCGCGAGGGTTGCGACCGTGGTGGAAGTCCCAGCACTTGACCACGGCATCGTCGCCACCCGTGTAAAGATACTGAGGCGATG
CCGAATGGATTTTCAGCGCTCGAACGGCACGTTGGTGGAAGGCCTCAGTGCGGAACGGCGCGTCGAGTTTGCGTCGATCCCAGAAGCTCACGCGGCCGTC
GTCAGCGCCGGTAATCAGCAATTCGGGCCGCGTAGGGTGCGTCTCTAGCGTAGTCAAAATGCTCCTCGAGCTAGGACTGCGATGAAACCATTTCGAGCAA
TGCCACAATGTTAGTGTACATCAACACACAAACGCAGCGATCTAACGTACTCTGCGCAAGTCGTGACAGGGAACTGGTTGTTCGCCGCGAGGTCCCAAAT
GCGAAGCTGGCTTCCAGGGGTCGAACTACCATAAAACCATGTCGACGCATTAGCCCGCCAGAAAAACAAATCCACCCGggtccttcagctcgaacGTACC
CGACAGTGGCGACGACAGAGTCGCGGCCCAAGAACTTGACTGCATTGATCGGCAGTCTGCTCGTGTCCTTGTTCTCTGAATGCATCCAACACCCAAACGT
AAGTTCCAGTCCAAtgtctcctccaccttcctCTGTAGCACCCTTCCTACCAATCTTCTCGACGGccaccgcgtcgtccagcttgagccAGGCCAGAGCT
CCACCGACGCTGGCAGTCACAAGACTGGTGCAGTTCTCGCTCACCTCCACGCACGTGgccgcagcgccggcaaAAACCTGCTCCCACTGCGGCATCGCAA
ACTCGGACAGCGGTTTGGCCGTGTCGCTGTCCACCATGGCCGCATCGGTGTCTCCAGCACTGGAAGACACGcggaaggcgaagacgccacccgcggacga
cgcgctgaCCAGGAGGTTCTCACCCCTGGCCgccacgaactgcagcgcgttcacATCTCCCTCGTGCTCCGCTTCGGCCAGCGTGCTCAGCTCACACGGA
CGCGCATCGCCCTCTCCGTGTCTAGCAAACGCAACACGGACGGCAGTCAGTGTGCAGCCTGAAGACGCAATTGAACAGAGCTACGGACGCACCCGAactc
cttgcgcagctcccGCTCGTCGCGTGTGGGGCGCACAGGCAAGTGCAGCGACACGTGGTTGGTCTGTAGTTGTTAACGGAAGAGCTCGGCGTGAGTTCCC
AGCACTTGGTGCCGAGGCGTTGCGGCCACTCACCTCGTTGTCCCAACTGCCGGTCGCCACGAGAGGGAGCACCTCGAactcctcctgcagcgtctcggaC
GCGTAGCGGACGTCGCTCACCACGCACAGAGCCTTgaccttctcggccacgaagTGTCTCGACGCGGTCATCCTGCTTGGCGAT