Description :
From Genome Similarity Track
Location :
contig_26:248038- 249535
Transcript NameFunction/comments
g6746.t1hypothetical protein

Sequence
1497 bases(100 bases per row)
GCATGGTAACGGAGCCGCGCACGGACTTGGTGGCAGCGCGGTCTGAAGCCTTGGCCTTGACGTCCATGGCGGCACGGACACCAGACTCCGCTGCGAGGCA
GCTGGTGACGGCGGTGTCACGGACAGACTTGGTGCGCATGACCTCGGTGTCGGTGCTGCTCGCGGGCTGGTCGGGGCTGTTGCTCGCGGACTTGAAGGAG
GACCCGGTGTCGGTGCCAATGGCGACACCACCGCCTGATCCGTTGGAAGGACTAGCCGAGGTTGTGGTGGAGGGCGTGCGGCCGAGACGGGGAGGTGGTG
CGTGCGTCGGCGCTATTAGTCGCCGGGAAATGGGGAGAGATGGCGGCGGCCGCGCTCGCGCGACTAGAACTCCCCTGGAAGGCAGACCACTGAAAAAGCA
CCGCGGAAAGCTGCTTATGGTCTTCCCGTACGTCCTCTTGAGACTGGCCAGCCGAAGACGGAGCTCGTTCGCAGAGCGCTTGGTTTTCATCCGACGGGCC
ACATATGCCCAGGTGATGCGAAGGCCTTCCCTCTCGAACTGATGTGTGATCTGGACCAGTAGCTTGTCTTCTTTGTCAGTGAAACTTGTGCGCATTTCTG
CTAATTCTTGTATGTGAAATGAAGTCAGCATGTAGTGCATTTGACTTACCTTATGTATGGCGATGTGACTGGCTGCACGGTGATACTGGTGCTCATTGTT
TTTGCAGCGCTTGGTCGATGACGCGGCGGTGCGGCTGCGGCCGATTACGGCGGCTGAAGCAATAAAATACACCTCGGAGACACGAGCATTTGAAAAATAC
CCCCATCCCTCTTAAACAAAATGCTGTGATTGGTAGTAATATTACACGGTAGGTCGAGCACGGGATCAGGCTAAAAGGGCGCAAAAATCGCCCTTTTAGA
AGTCCATTTGTCACCGTGTTTTGGAAACAGCGTTAAAGGGCGAGAAATGCGCCCTTGCACCGCGAAAGGGTTAAATTATTGACTGGTTCAGAGACCAGGC
GATTCGAGTCTTTTGTTGTTCACGAGGACGTTTTTTTTTTTTCGGGAGTTCTTTGCCCATGTGGCTTCTTTTAATCCAATCAAAATGATTTATTTTTTAT
GCCGAGTTTATCAGTCGGATGCAGTACTTGTACTATACTATAGCGGATGGCGTTCAGCAGCGTCGGCTTTTTTAGTCGTTGTCTGTACCTGATCAATACC
TAGACGGAGTTGGGTTACAGGCTGTGTGACGCAACTTCAATCTGCATGGGCTTGAACCTGTTGCAATGTTGTACCTAGCAGTTCATTACCTATTTGCCGA
CGTTAACGAGCCGCAAGAGTGCCTTGAGTGCTTAGGCAAGACGCCATTGTGATGGTTGTTCCAGGATGGCATCAGCAAGGACCGGGTGCGATCGTTCGTC
GTGCAACATGTCTGTCAAAGCTGACTCAGCGTATTTCTAAGCGCATGAAAAGGAAGCATCGAACGGCGATTTCAGATTTCTGTGTAGGAAGAGATGG