Description :
From Genome Similarity Track
Location :
Scaffold_17:248005- 249558
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007103Protein of unknown function

Sequence
1553 bases(100 bases per row)
GTTGACTCGAGGCGCGAGTACGGCGGAGGGTTCCTCGGCAATCCGTTGCCATTCTCGAGATTGATCACCTCGTCCGACGTCGCACGATCTCTGGTGTTCT
TCTTGTTCTTGCACCCACGAACCAGTTTGTGGATGATCGTGTACGCCTGGCGCAGGAATAGCAAGAAGAAGATGAAGATGTTGACGCCAATGATGCCGTA
CGCGACGTTGTCGCGCACCGACTGCGGGAAGTAGTCGTCCTGCACGAGCATCAGCATCATGCACACGAGTACGACCTTCATGAACACAGACGTGATCCCA
ATGTAGTACAGGAACCGCAGCAGATTCGGCTCTCGCACGAGCAGCAGCATCAAGTACAACATGGTGATACCAAGGATACACAGCAGCTGGGTCGTCCCGT
TTTGGATGGTACCGACGACGGCGCCAGTGCTCACGGCGAGCAGGATCCGCGGCACGAAGAAGAAGCGATTGTCGAAGTTGTACTCGTCGTAGTACGGGCC
ATACTTGGCGCTGAATGGGCGCTGATCGTGCTCGAACGTGCCGATATCCTCGAGCTCTTTGCGATTGGCCGAGATGATGAGCACGCCAAACACGAGCGCA
AAGCCGACGACCACGATCAGTCCGATCGTGCCCCACACGAAGTACGAATCACGATCGCTGCTGTCTGCATTCTGGTAGATGTAGTAGCTCCCAGCCATGC
TAAAGATGTACTGCGCCAACAGCAGCGCCAGAATACACGCCCATATGACTTTCTGGTACAACTTCGCCGCGACTTGGCCAAACGATTCCTTCTTGCTCAG
CATTGAGAAAATGGCGACGCCGATGATGTACAGTACGTGGATTGCGCCGACGACGATCGCGAAACTGAGCAGCGTGTAGAAGAAGAGCCTCTCTGGCGAG
ACGCCGATCAGGTCGGCGTACCGCTTTGGCCCCGTCTCGCCGCTCGCCGTCGTCGAGAGCAGACTGGACGACTCGAGTCGTCGTCTCGACGTCGACGAGA
ACCTATCGGTGATGGACTTGGGGACGTTGAAGTTCGTCCACGCCATCTCTCGAGAAAACTGGTGCAGGAACACGGGCGCGCCGTCAATCTGGAGCTGGCT
GATCATGCCGATGAACTGCGCCTGCTCGACGATGTGGGTCATCTCGTAGAAACCACTCGAGAAGCTCATGACGGACGCGGCCGACGGAAAGAACGACGCC
CAGAGCATCGAGCCGACGCCCGCGGCTGCACCCGCAGCCAGCGACGTCGCGATCACGGCTGAGGCCGTAGGGCCAGCGCTCGTGTCCAGGAAATGCAGCG
CGCCGGTCGTGTTCGTGGGCCAGTCGGTGTTGACGCCAAAGACGCACCCGGAGCAGTTGTTGGCGGCGATCACGCTCGCGTTCAACGAGCCGATGTCGAC
GTCGCTGCCGAGGTGGAGCGCGTCGCGGATGCGGTCCTCGCCCCACGGCACGGCGTACAGGTAGAACACGAGCACGAACGCCGCGAGCACGCCGAGCGAC
ACGAGGACGCCGATGAGCTGCGAGAGCACGACGCACCCGCAGCACTTGACGGC