Description :
From Genome Similarity Track
Location :
Scaffold_2527:248- 2802
Sequence
2554 bases(100 bases per row)
AAGATCCATCCGGATCCTGACTCGACACTCCACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTGCAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCA
CCTTGGACGCTGGAGATTGTGAAATGTTCGAAAGGGGAAGACGAGATCCTGGGAGTCTTGGCCGCGAGCATCACTCCTCGAGCTAAGATGGATGAGGCGC
TGACTAGGATCGCCCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCCGATCCCGACGGTACAGGTGGATGAGGATCTATACGTCCTGAGTTTCGATGG
ATCCGCTCGTGTACGACGCGGAGGAGGAGCATACAGTGCAATACTGTGGAGATTGCCCGGATGGGAAGTTGTACGGGCCAGATCCACTTACGCGGAAGGC
CTCACCGTCAATGAAGCGGAGTATAACGGACTCCTTCTGGGTTTGGATTTACTAAAGGGACAAGATCCAAAACGGCTGGTGATTTGTGGGGATTCAAATT
TGGTAATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCCCTAACACTGTTACGGCAGAAAGTGATGATCCACCTGCGTGGTTGGTTGAATCA
CGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCGGATGGTTTGGCCAGTGCCGCTTTACGGAATCAATGTGGTGTCGAAGTGGAGGGAGAAGCC
GAACATCAGGATCTCGTTACGTTGAACCGACTTGACGAAGTGGTGGTAGTTGGATCCGGGAAAAGGACAGTCCAGGTGATGGCTGTCACTAGGTCCAGAG
GAAAGATTGGATCCAGCCCCCCGATCCTCGAGGAAACATTCGTGAAGAGAGTTCGCATCGAGCGGATCCTCAAAGCACAGAATGAGGAAGCGTGGATCCT
GGGACTAAAGAAGTATCTGATGGGGGATGTACGAGACTTAAGTCGGGAGGATGCCAAATCCTACAGCGTTATCGCTACGGATTACGCAGTGGATCTGAAC
GACTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTCCACGAGGATCGGGATGGATTGATGAGATTGGTGATGCCAGAAACCTTGCAACAGGATGTCCTAC
ACCACTACCACGCTAGCTTGGAAGGCGGACATCAGGGCATTGGTCGGACCTACCAACGGATCCGGGAATGTTTCCATTGGAGAGGACTATTCAAGAGTGT
ACAACGATATGTCGGTGAATGCGTGGATTGTGAGACAGGCAAGGGCAGACCTACGATCGAAGGGGAGTCACCTGGGAATGTCCGAGCGACTTACTCTTTC
CAGATCATAGACATGGATCATATCCTCTCGTAGCTCAAGTCGTTCAAAGGAAACACAGAATTGTTAATTTGGGTGACCTGTTTACCGGGTATGTGATTGC
CAAAGCTAGTGCGTCTAGAACTGCGCAAACCATTGCGGATCGTACGAGGAGTGTGTTTTCCGAAGATTTGGTGCTAGCGAAATGATTAGACATGATCGGG
AGCCAGGCTTTATGTCTGATTTCTTTCGAGCATTCAACCGGATCCTAGGGCAGCGACAGCGAGCAACCATGGCATATCGTCCCCAAGCTAACGGGTCGGC
CGAACGCATGGTGCAGACGATCACGAGAGCACTCAAGATGTATGTCCAGGATTTGGATCAAAGGGATTGGGATGAGTGCGCAGAACGGCTCCCCTTCGCG
ATGAACACCGCCCAAGACAGGATCCGGGGTGATACTTGGTACATGGGTGGGATCCCAAATCCACCCTAGAAGCGGCCATCCCAGTATGCAGTACCAAGAA
GAGAAACTGAGATCCAAGGCGATGGCGATACCAAGTCCAGAAATACCACCGGCAAGCTAGATCCCAGGTGAACGAACGACTGCGGAGTGCGATACAGGAT
CGAGCGGATCGACACAACGAAGACGCCCGTCCACATCAAATCCAAGTGGGATCGCAGGTGTGGCTTTATTTGGATCGAGTGAAAGAAGGGTACGCTCGCA
AATTGGCCCATCTATGGCATGGACCGTTCCGGGTGAGCGAGAAGATTGGAGAACATGCGGTAAGGCTGGAAACGGCAGGTACCGAATATCGCCTGTTCCC
TGTAGTACACGTATCCAAGCTGAAGTTGGTCAAAGAATATCCGGATCGGCCGCAGATCCGTCTTTCGGTAGATGCATCCGACCGCGTCGACTTCGACGAA
GTTCTCCTACCGGAAGATAGTTGGAATGTGGATCTCGAAGCCGACGAGTTCGAAGTCGAGAAGATCACCGATATGAGATCGGGGAAGCGAACTAGATACG
GACGGATTTACCGTGAATTTCTGGTGCATTGGCGTGGATATGACGAGCCTAGTTGGGTAGACGAGGCAGATCTGAACTGTGGAGCATTACTCTATGATTT
CTTGAGGGATCGTACGAATCGTGTAACGGGCCAGGTATTTACTCCGTTACTTGCTTACACTATAGTGTTGAGGAAGCTCGCAATAGGACGACTGAGTCTT
AGGTTTAAGGAAAAATCAACTCTGACTTTATTTTAGGACCAAGGCCACAGCCCT