Description :
From Genome Similarity Track
Location :
Scaffold_50:247969- 249037
Sequence
1068 bases(100 bases per row)
TGTAGCGGTGCAACTACGCCCGGATGATCCATTAAGTCGATGAGAGGGGCTGTGGGGTCAAGCCTGCACGGGACACAGTATGCTGTTCGGGAAGCTGGCT
TAGGAGAAAAGCGGTGGGCGCCGATTCCATCGCCAAGGATAGCGCAATGGCCAACATTGGGCAAGTGGTAAAATCCTCGTCCGGAAAAAGAGAAAGACCT
TGCTCTTCGAATGTCTTCACTCGAATGAAGCGGACGAAGAAGATATTTCCCGAGCCGATCGATAGATTCTCCTTTCGCAGTAACGTGATGTCAGACGCTC
GTCCGAAAGAAACAACAACGGACACAGGATTGCTGTATCGTGATAGTCGGAAGCCGTAGCAGCAGTTGAATAGTCATTTTCTTCAAAGCTTCTTTCGTAC
ATACAGGTGCCTTGTTGACAAAAGTACCGGACTCGCGCTTCATGCAGTATCGCTCCAATACTTGAGCAGATTCTGCTCCGTCGCTGGTCGAAGCAGTGGA
AACTGCTCTAGCAGCCAGTTCTTGCCCTGTCGGTAGCACTGCATCACCGAATGTCTAGCAAAAAGCTGATCGTTGCGGCCTTTCTTGAAAGCTAAATGCA
TGCCGAACTTGTCCACCACGTGCCTCTTGCACGGTAGCAGCGTTATCGCGCTTCATGCACACCTCCAGGTACTCCATGTCACGCCTTCCTCATTGAGGAA
GCCTTGAAGGAACGAAACGCGCTCTCGCGTGCGCGCGTTGTATTGACAGGTGCAAGGCCTGAGAGACTCATGGAGTGCCGGAGAGGTCGGGGTTTGCGTG
TTATGTGTGAAATACGCAAATGATTTAAAAGTTTGTAGGGGAATATCAATAATAGCTAGTATTGCTCCGACCAGATATGTCGGAGCTGTTGCTTACAAAC
GCAACTCGCATTGGATTGGTCAAAATAATGCGCTATCTTTGTTTGATTCGATGAATTGAAATCCAGGCCTGCTGATTGATCAGTACTGTTATAGTGAGTT
CTAGTATTGTCGTAGGTTTTAACGATATTAATCCATAACGGCACCTGGTGCAGCCTTGCGGGACCGAG