Description :
From Genome Similarity Track
Location :
Scaffold_114:24793- 27156
Transcript NameFunction/comments
g14397.t1RAW39124.1 hypothetical protein PC110_g4627 [Phytophthora cactorum
g14398.t1RAW39127.1 hypothetical protein PC110_g4628 [Phytophthora cactorum
g14399.t1RAW39128.1 hypothetical protein PC110_g4629 [Phytophthora cactorum

Sequence
2363 bases(100 bases per row)
CCAGGTCCGCGCTCAGCAGTCTGGACAGCCGCCAGACCGCCACAGGCAGGACTCGGTGCCAGCGCACTGATTTGCCCAGGCCGCTCACACCCGAGGCTAG
CGAGAAGCTAAGCAGCGTGAGCACGAACACGAGCGTGATGGGCATCCCCGCCAGCCACCACATCTCGAAGCCGTTGTAGAACGTCTTGGCCAGCCCCAAG
TCGTGCGCCGCGTCCGCACTCTCCAGCTGCGACAGCGTCTGCCGCCCGAAACTCTCACGCAGCCACACGACGCCGCTCGCGTTCTCGTCCATCGCTACAG
TCCAATGTTGCTCAATGCAGCGCCGTGTCAATGCAGCTTGGTCTGGTCTCCAGTGACGTGTCCAGCCTGAACTCCAGGCAATAATGACATGCGACATGAA
TCGTTTACAACTTTCATAAACAGCCAATCAGCGACGGCGTGCTTTTCCACCATTGAACAAGATGGCGCTGCTGCAGTCGAGATGGCTTCGACTAGGCGGA
CCCGTGCGCTCGTCACTAGCCGCCACGCGATGCCGTGGATGTGACCACTTGATCCGATACTTCAGCGGCTCGACGCCGAAATTTGGGGCCTCAACTTCAA
CGGGGTCACTGCTTACCAACAACTCTCCGTCGGGCTCCAAACGCTTCCGGCAGCACGTGAACCCGCTCTCGATGGTCTACCGCCAGCCCGTGGAGCTGCC
GCAGTGGGCCGATTGCTTTGCAGACACTTCGCTGCCCATCCACCTGGACATCGGCTGCGCTCGCGGCAAATACCTCATGGATGTGGCGGAGTCCCAGGCT
TCTCAACGGAATTTCGTGGGCGTTGAGATCCGTCGCAACGTGCTGCAGGAGGCGGAGCGGGAGGCCGAACGGCGTGGACTCAAGAACTTGGCTTTTGTGC
ATGCCAATATGAATATCCACCAGGCGACGCTGTTGCAGTCGTTACCTGCACCGGTGGAGAGTGTGTCCATCTTCCACCCGGACCCGTGGATGAAGAAGCG
CCACATCAAGCGGAGATTGGTGACCGACGAGTTTGTGGAGGAGATGGCCAAGCACCTGCCTAACGGTACGCCGATCTACGTGCAAACGGACGTGGAGGAA
CTGTTCGCGCACATGGTGGAGATCTTCGAGCTGTCGAGGCTCTACGACTTTGACGCAGTGCATGAGAACCCGCTGGGGATCCCCACGGACAGAGAGAAGT
TCGTCTTCGACGAAGAAGGAGATATTTACCGGGTCAAGTTCATTGTGAACAAGCCAGAAGAGGAGGCTGAGGAGACGCCGACTTTGACAGACGCATGACG
CGCTGGACTCGGTCGTGGCACATTACAGTACTACAGAACGTGCTACAGTAACTTGTTTTCTTTTCTTTTGCTTCATTGACGTTATGCTACGCGTGTGTTT
GAACACGTTGACTTCTGATTAGATTATGCAATGCTGGGAGCTGTGATGGTCGGGTTTACTTGCCAAAGCGGCGCTTGCGGCGGTTGAACTCCACGATGAT
GTCCTGCAGGTCTTCGCGCGTGACTTCCGGCCAGAGCTTGTCCATGAAAATGAGCTCGGCGTAGGCAATTTGGAATAGCAGGAAGTTGCTGATGCGCAGC
TCTCCCGACGTACGGAGCAAGATGTCCGGATCGGGCAGGCCACTGTCATGCAAAAGTGGTCAAGAGTGAGCACAAGATTGAACGAAAGGCAGAACACGAA
AACGTACGCAGTAAGCATGCGCTGACTCAGCAGCTCCTCGTCAATGTCGTCGATGCTCGTCTCGCCCCCGGCGACCTCGGCAGCGATCTTCTTGCAGGCT
CCGACGATCTCGTCCCGTGCCCCGTAGCTGTAAAAGCGCCATCAAAAAATTTCGTTAGCCTTATGAGTGGGGACGGCTTAGGTTGGAGTTGTTGAGACTG
CCCACCTGACGCAAAGGTTGAGGTGGAAGGCGTTGCAGTGCTGGGTCTTGGTCTCGACCTCCTTGATCGACTTGACGAGGAACGCGGGCAGCTTACTGCT
GTCGGAGGCCAGTACACGCACTCTGATGTTGCGGGTGAGCGCCTCGCCTAGGATGTCATGGATGAAGCCGTCGACCAGCTTCATCAGAGCATCGATCTCG
GCCTTCTCGCGTTTCCAATTCTCTGTAAATGTACATTGGGTCAGTCTCGCCGGCAAATAACGGAGACTTTGGAGACGACGCCACTTTACCCGTGGAAAAG
GCAAAGACTGTGAGCGCCTCGACGCCAGCGTCAATACACCAGTCCGTGAAGTTCATGACGGTCTTGGTGCCGTCCGAGTGGCCGCGTGTGCCCGAGCCAT
ACTTGTTCTTGCCGTAGCGGCGGTTGCCATCGATGATGACGGCAATGTGGCGCGGGATCTGTA