Description :
From Genome Similarity Track
Location :
Scaffold_39:247919- 252319
Transcript NameFunction/comments
Phyca_LT1534119622chromodomain protein putative
Phyca_LT153451452AlNc14C91G5710
Phyca_LT15349559Hypothetical protein

Sequence
4400 bases(100 bases per row)
tacttattctgcgatcataggaacctcattcacgtgtttgcgccacatgcaagtgtcaaaaaacatatccgtggcaaacagctgagatgggcgttgaagc
tgatgtcctaccgatacgtgatagagcatgttgacggtgtgggcagacacgctgtccaggtgggctggacaaccaatggccgctggtcgcttgaaacgcc
tcgctcgtcgacgacccaagcgaaagagaaacactacgatgtcgtcatgctacggccgctggatgctgaaagtttcgtgtggcctacgctagcagatatc
gtgacgatacagcaaaactaccacgtgccgccaggagctgtgaaaggtgacgccaatgttctacgagtgtaacaacgactgtggatccttcgggcggaca
cagatctaatcggaaggttgtgtgtcatcgcacattgcggtgcgcaaggccatcggggagaacaggccatggtcaatcgcctgtgaggactcttccatat
tgcagacgtccaccgagtggtacatgaattcgtggcagcatgcttgctctgtccgcacatgaaaggtagacggatcattcgccggccgtggagtgaaacg
attgagtgcagcgatcgtaatggagtactacactgggattttctttcatggagaaatcttttggagaaagcaagtatctcctggtattaaaagatcatgc
aacacactactgtgagctggtggtttgtgacgccgcagacagcgcggtggtgactactgccatccttgattggcactgccgacgcttccagtgtgggtga
gtgacaacggtagtcattttaagaatgatgacgtggccgagctttccaagagattaaagacgcaccaaaacttcacactaccctacagcccgtggatcaa
cgggtcggtggatagggtgaatcgtgacgcgttacaagttctacgcgcgatgattctgggttataaaatctctaccaaggattgggtctacttagttccg
ctggttcaatccagcctgaaccacaccgccgtgccatcgcttgggaacagagccttcacagagctgttcacagaacttccgtgccctgcacctctcgctg
agttctacgacgccagcgctagtaaactggtcaaagtcccgtcgacttcggtagccatctcccagcagctggccacattgcgagccagcctacagcaaat
gcacaagctcgttgctgaccagcgggtcaagcagcggctgcccaacaagaagaaagagcggggagaaaacgtcgtcaacttcaacgttggggactttgtc
ctacgatagcgggtcgacgataaaagggcagcaaacttttggccacgtggcaaggtccttacaaggtgattnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnacgtgaccgaggaaatcctcgagcatgta
gccgcccaaggcatcatactggccatatataagctgaaaaagcattggtggaatgcctccatcaacgaccacgagatcgtagtaggctggaaaggcctag
agtctgtagaagattcgtggaaacctttggcttcctttgaaatagaattcaaggttctactagaccagtacgtacaatttgtacggtacaaaagcaagat
gccaaggtacgcaagtactggaaggataatcattccaaaatttgactaaaagtccttcatactttggccgacacttgtgttaacagcaacaccagctaac
caaacacatatcgagccctagctagagaagatcagccaagtgctcactttgtcttttacctaatagactcggccatacttccagggagctgacgactccc
ccatcgtgtcttcaatccctgcagacactacagttcgcattaaatgccactacttaggtgggcattccgaccatctgttgcttgtataaaccgcaatgga
gatggtgggaaacgtgctagactttgtttattggtgatgaggtgtattgggttaccagcttgctgcctgaactctaataaccattcccgactagcttgtg
ttgcatcgtcgagttgtccttgctcctctccttcttagctacttcttcctcttgccttccgtgcttgctatctgatgcctggatcacgttcgctgcgcac
tcctttcctccattggctgacgtccccttgtatccacatctccaccaatgtcagttcgtgatccaccccctccgcctccgccgtgaatatcacgctcttg
cccgtgtccatggcgaaatttgccagcccgtctgctgtattgttgtgctggcggtagtggtgcttccacacttggcctgcccctgatccgccagcttcct
cactagtctgaaccagtgctgcaacttcctcgctttgggtacctttcgccgacgcatgagtcccaggatcatggcgctgtcgcccacgacctgcatccct
cgccatctcctagcaactccctccgtgagtagcctctgcagtcccacaaattcagccacattgttggtggttcgtttgttgctcagggtctttgccgggg
cccacagtatctttggcctctcgctctccccggtccattctactatcacgctgccacttcttccgggtccgggatttccccgtgagcctccatcgaagaa
gcccacccgtgtcccgctgcctcctccatcttctgcatctgtctgcctagtggcagccgcccatgttgcgagtatccgctttgccacaattattctctcg
tgcgatcttagtgttagcgggaacagtcccaatttgtatctcaatatcgtgtcctgcaacgacgccttcaatctgttgactgcatcttccagctgtccgc
tgtcgatgccgtccgggtgcacttccgctaccttccatctccagattgccgtgattgttgctgcacatcccattatccacgttgatgctgctgcttcctg
tattgcttcccatctttccacttcctgcccgtctccccagtctatcagccactgtggaagcttgcttattgtcaaggagcatatatctcgtttcagcgct
gagtcacttccccattcgcttcctagcccgggcatcccccatgcttccacctagacactccaaaagtccttggcgtccgggcaattccacagcaagtgat
cttgcccgctctctgtgcagttggtgcatctcgtccctgcgcatttgtacttcatctcctttcctctccataccctcaatctccccattttcatcctcac
aatgttttgtttctggtacgctgttaccccgtgcatccgctgtacactcttccacgaaaattgcttcattgccctgttgatgtctgtgtttgattgcccc
cttttgatcctcctgcgttcttgttcttttgccacggcgctgcggcgcttcctccttactacgtccttgtttgcttgacgcgatcgagtccatcttctct
tccccgcccatagcggctgcatgtgtgtccggtctggatgtggcgttacccaaaccgccttgggcgccgttttcagtagctctgctatattaacactttc
ctccgccgcgccgtcccccatgtttaccgccttctccgtgaacgcccagccatgcctgacagtcgttcgcctgtcagagcgctcgacccagaagcgatgg
tgtggatcctttagtccatgcgagactcttaatttggtcgcgtcttctggtttgaacactagctccgggaattgagccaatagtaagaggtgcgcttgcc
tgctttccatcggcatcaccgtggagtgcggttgcactatcaccctgcctttgctctcgtacttgacttccatcaggtatctcaccagttgcgctccctg
tcattctgttaacctcctgtatgccgaccacttccgtactgccccagttgcgtcccgcggcgccagcctcttgtacggcaggtctggcactgtttgatgt
atcagcgcttctgtcattcgccccagtatttgtgctccaaattcacacaccaaccccatcttaccccaggtcgtcttcatgccgtttttcagcctcatct
cccgccttatgtccgccgtactgtcttcactggttccttgcggcatctctggtgccaatcctgactcgacaatcggcttgcctgtggtccagatgtctcc
gtgtagctttggctcagcgctgttcgcatgtggtataatgtgtccgatgttgactcctgcatgttgctgtagcaactggcctgcgctctgcttgctcttg
gtcgcggcggtggcccatgtccccactgtcgatgcggccagtgccatcaactctgttctgatgtttggcactcccagccctccttccttgggtcttaatt