Description :
From Genome Similarity Track
Location :
scaffold_6:247908- 250102
Sequence
2194 bases(100 bases per row)
TCGTTCATGGCAAACTCAACCAATGGTAAAAACGAACTCCGTCCCGCGGGATTCCCCGCGCAAAAGATTCTCACCACATCATCAACGACTCGGTTGGTGA
AATCTGTTTGCCCATCGGTCTCCGGGTGTACCGCCGTGGCCATATCAAAGCGAATGCCAGAATATGAACAATACTTCTCAATAGCCACTCGTAAATTGTG
TATCACGATCAGAGACGATGGCGTTTGGCAGCCCGTAATTGCAGAAAtgtgatcaatgaacaatctAACCGAACCTTCGGTTACCGATTGAACGCTACAT
GGTACGAtgcgaaccatcttgctgaatctGTCGATGCAGACGAGCACTAAATTGTGGTCGCCAACATTCTCGGTGATACCGAAGGCAAAGTCAAAATTGA
CTGACTTTCAGCAGTCAACTGGAACAGAGAGACTCTGCAGTGGCACTCGCGTTTGCCGTGCGGTCTTCACGCGCTGACAGACATTGCATGTCTTCACATA
TCGTGTTGCCCACTTGTTCATGTGGGTCACCACAATTGAGCACTGAGAAATgataggtcttctcacggcaAAGTGACCGATCATGCGCCTCGTACATTAT
CTTGTAAAATCATCGTTGTGGAAGTTGAAAATTGGTGGCTCGTCGTCATGTGCAACTTCATCGTGAGTGGGACCATTCCTCCATGCATACCGTTGCATCC
GTGACCAGGAAGTTTGTCATGAAGTTCTATATCACTCGATTACGGTGTCTTGTTAATCAGATCACGCTATTTATCTCTAACATACACCGACGTATCATAT
CGAATACTTCGTGTTTGATATAGCTGATATGGGTTGGCTCCTAATCAAGACGACGAGAAAATACGTCAGCCTGCACGTTCACTTTACCCGGCTTGTATGC
GACCGcgaagttgtattctgcgGAGAATAACAACTAGCGAGCTATCCGATGTGACAAGTGAGAAGACTGTACTACATATTGCAAGCTTGAGTGATCCGTG
TAGACGACAAACGGAGATGACCTCAAGAGGTGACCACGATACTTCACCgcagcatacttcattgccgAAAGCTTCTTGCTGTGTACAAATTAATTTCTTT
CTGCTGGCTTCGGCTGTCGCGATCGGAATGACACGACTTGATTGTGTCCTAGTGATTCTATTTTGCAATAAAGCACAATCAAGTGCAAACTCAGCAGCGT
CCAACATCACGCTATATTGCTCTGTATCGTTAAGCAAGCAATGGTGTTTTCATCAAGTTATTTTTGGTTTGAGCTAATGTTTCATCACAAGCGGACGACC
ACTCTCATAGTacgtccttcttcagcaagtttaATAGCGAGCGTACCATATCCGCGTACCTACGCGAGAAGCGAAGCAGGTAATTGGAGAAACCAATCCA
CATTCTTAAAGCCCTTTGATTTTGTAGCGCCGACCACACCACGATTGCTTTGATCTTTTCAAGGTCTACACGGGCGCTAAGCTCACCAACGTAACAATCG
AAGACCGGTTCTTCGTTAGCACCGAAAATATACTTTGCTTGCAACGAATATTTACGCATACATTTCAGCACTAAACAGAAGTGCTCCAAGTGCAGGTCTG
CCATCTTCGTCCTTCGAATAGACATAAATATTGTCAAAACTTAGTGTACGAAGCGTTCCAGTGATCGAAACAGACGTGAGACCAATCGATTGAACGTTGC
TAGGGCACCTGATAGTCCATGTGGCATCAGAGGCCATGCCCATAAAATACCGGACGGTGTATGAACAGCCGTCAAACGGACGTCCACCCCATCCTTATGG
ATTATAgtatccatcgaccaaatcaagtACACTAAACTGTGTACAGCCGATATACGGTGGAAGATGACCATTTACGATGAAACAGCGTTTGAGCGAGAAT
CGTCTGCACATTTAACTTGTCTAAGGCGTGATGGATACGCCATTTATCGTTTGGCTTACGCACACAAGACGtcgttgcgctttgaggggATTTGCTCTCC
CTCACTCGACCAGCACCTTGTCTTTGAGCAAAAAACATGTCTATGTACTTACTTTGTTTACGCAACAGTGGCTACTGTCGAAGCACTGCATTCTTTGAAC
CAGGTTCACGATCCATTTTGTGTCAAACTCTGCGTTCATGTGGAAGACCAGTGGGCGGGTTCGCACTAAAAACATCATCCTTATATTTCATAAC