Description :
From Genome Similarity Track
Location :
contig_14:247893- 249589
Transcript NameFunction/comments
g3689.t1POM76356.1 Putative Glycoside hydrolase [Phytophthora palmivora var. palmivora

Sequence
1696 bases(100 bases per row)
GTGGGATCTTACCTTGGACTTCCATTATCGATCTTGGGTGAAGTCAACGGAACTTGGGGCTGGACGACGACAGAAATGCGAGCCTTCATCCACCGCATTC
AAGAAATCACCATGGAAGAGAACGGCGGTCACCCAATGATCTTCGGTGTGGATGCTGCTCACGGAAATTCACTTCTGTCAGACACGGTGTTCTTCGGTCA
CCAGATCAACGCTGCTGCCACGTTCAACCCGGACATTGCATACGAACAAGCTCGCATCACTGCACGTGATGCGCTAGCTGCTGGCATCCCTTGGGTCTTT
GACCCCGTTCTCGACATCGTACACAACCCGCTGTGGCCGCGCGTGTACGAGACGTTTGGTGAGGATCCGTACCTCATTTCCACCATGGGGGTCGCCATGG
TCCGTGGTATCCAGAGCTACAACGAGTCGGCCGCATGCATGAAGCACTGGATCGGCTACTCGTGGAGCGCGACTGGCAAGGATAAGGACGGCGTGGAGAT
TTCAGATTATGACCTCATGAACTCGTACTTCCCGCCGTTCAAGGCCGCTGTGGATGCAGGTCTGTTGACTGGAATGGAGAATTACATTTCCGTGAACGGT
GCCCCTGTGATCGAAAATACGAAGCTGATGACGACGTTGCTGCGCGAGGACCTTGGTTTTGATGGTTTGATGGTGTCGGATTATGGCGAGATCAATCAAC
TCACAGAGTTCCATCGTACTGCTCGCTCGACCGAAGAAGCCACCAAATTCGCCCTTGAGCGCACGTCACTCGATATGAGTATGGTAGGCAGGAACCAGGC
TTTCACGAATGCAACCAACAAATTGATTGAGGAGAGTCCAGAGATCATTGACCGCCTCAAACAATCTGTGCGGCGCATTGTCAAGACGAAGCTGAAGCTC
GGCCTCTATGACAACCCGATGCCTGGCGCGGAGTACGTTGACATGGTTGGTAGCGATGATGACGTCGCCGCCGCGTTATCTGGAGCTCGCGAGTCGATCG
TATTGCTGCAGAACAATGACAGCACCCTGCCTCTTTTGAAGAACGCATCAGTATTTCTGACGGGCCCCAGCGCACACAACATCGGATACCAGTGCGGTGG
CTGGAGTCTCCAGGCGTGGGGGGTATCCGGTAACGACATGTTCTCACACGGTGTTTCGGTGAAGCAGGGCTTCGAGGTAATTGCTGCAACGATTCGTTCA
CTTACTTCAACGGCCTGAATATAACGGGTAACTACACGGATGTGGATCTGGCGACTGCAAAGGAATACGCCAGCCAAGCCGAATATACGATCGCAGTCAT
TGGCGAGGAGCCGTACGAGGAGAAGTCGGGCGATATCGACGATCTCTCGCTGCCTGCTGGTCAAATTGAGTACGTGAAGGAGCTGGCATCGACGGGAACT
AAGGTCATCGTGGTGCTGTTTGAGGGCCGTCCGCGTCTGCTGGGTGGCCTGCCGGAGAACGTGTACGCCATCCTGAACGGCATGCTGGCGTGTGAGCTGG
GTGGTCAAGCCGTAGCTGAGATCGCCTACGGTGATGTGAACCCGAGTGGCCGTATGCCTATCACGTATCCCAAGGACTCTGGCAACGTCATGATCCCGTA
CCGGCACCGCGTGACCACGCAGTGTGCGACGGGCGACTACTGCGAGCCACAGTGGACTTTTGGCCACGGTCTCAGCTACACTGACTTCACGTACTC