Description :
From Genome Similarity Track
Location :
contig_37:247892- 249519
Transcript NameFunction/comments
g7600.t1hypothetical protein

Sequence
1627 bases(100 bases per row)
CATAAGACATCTTCATGCCGGCCACGCATCGGGACATCGATTCCTTGTGGTCTACAATAGGGCACGGATAGTCTTTGCCGATGATGCATCCTGTGGCATG
CTGCAGAGTCATTGGGGCCTTCCACGGTTCATAGATATACTTGGCAGGCATCTTCTTCAGCGCCGGGATATATTTACGAATGAAGTGGCCTTCCGGGTCC
GATTTCTTGCCAAAGCTGATCGGAGAGTACACGCGGAAGTAGGCCGTGAAGAAATAGCTGCTGCTAAGCCAGAGCCAGTTGCCGGCGTTAAGACTCCAGT
CGTGGTCTATCAGGTACTCTTGGAAAACCTCGAGTCCACGCACCCACGAGATGTACAGATCACCGCGTGTTAGGAAACATGCTACTGAGTGACGCGCCAA
GTGATGCATCCAGCCTCCTTCAGCTGAGTCATGATGGCGTCGATCCAAGGGAAACCAGTCCGACCCTCTTTCCAAGCCTGGAACTGCGAGCGAGCGAGCT
GGTCGTCATCAGTCATGTCCTCCTTCTTGTCAGGAATTATGTGCCAACGCCAATTGACCTGCAGACACGTTGGGCTTTCTTCCATCTTGTCAAAATACGG
ATTCGCATGACCATGGCAATGGTAGAACTCCCGCCAAAGAAGCTGTCCTTCCAAGCTCACAGGAGGCTGCGACATCATTTTACTGCGTTCTTGAATCGCC
TTCAGTTATGAAAAAACGTCCGGGGCTCATGCAGCCGTAAAACAAGTATGGGCTCAACGCTGTCGTCGAGGGCGTCGGGGGTATCTGCGCCGGGGACGTA
TCGGGCTTTTCAAACTTGGCGACACGCTCTTCATCTTTGCAGTACTCTTTCAAAATGCCCAGCGCTTTCTGCTCTCCACCATACAGGAATGAATGTCTCT
TGATAGCCTCGTAGCCAAAGTCCGTCAATTCTGGAAGCGTAAACAGCTTGTCAGGGCCCGCAATCTCATCAAGTTGGTTGTTTTTTTCTTCCGGATCCTC
CTCCTCCTCTCCTTCCTCCTTCTGTTTCACCACGTAGTCCACCTTATTTCTATCCTTCCAGTAGTCCAGAACTAGTTGGTACAGTTCACTGGGCTTCGAG
GCCAAAGCAGGCAGCGTCTCTGGCGTGGGAAGAGGCTTGGGCGGTTTGCGTTGCTTCCCCACTTGGCGAAGGAACATCTGGTAAGTCTTGGGAGCTCTGC
CTCCATAACCTTTGATCACTGCATCCAAATCGAACAGCTCGTAGCCGTGGGTCACTTGCGTCTGTACGCCCAGGCGCTTGGCCAGCGTCTGGACGCGATT
GTCCCTTTCCACGGCGTACGGCTCGCTCACTGCATCAAAAATGAGGTGCGTCACACCCCAGGTAGGAAGCAGCCGTCTTAGTACTTGCAGTGCGTCTCCT
TTTGCCACCACAAGTCGCGAGCCGCGCGTCTCCAGCGCTTGAGCCAAGTCCTGGACGCTCTCGAGCACAAACTGGAAGCGGTTGGCGCCGCAGCGCATGA
TCTGCGGGCGGTGGATGACGTACAGCGGGATGAGCTCCACCCCTTGCTGCTGCTGCATCAGCTGCAGCGCCGCACTCAGCGCCAAATTGTCATGCAGACG
CAGGTCTCTCCGGAACCACACGACCAC