Description :
From Genome Similarity Track
Location :
Scaffold_105:24787- 29299
Sequence
4512 bases(100 bases per row)
CACCGAGAAGAGTGCAGCCCGCCCTACCGACGGGTTCACAAGGTGAGGAAGGAAATACAAGGCACGCAAACGGAGTACCCCCTCCGATAGTCGGTCGTCT
GGGCACCAGTGGAGAGTCGGGATTGCCTCATAAAATGAGAGATCGCCACTACATCACAATGGTGCGCGTGCCCGGATCTTCTGGTGACTCGGGATTTCAC
CGTGAGTCCCTGAGTGAATATGAGAAGGTCAAGGTTGAACCTGGAATGGAAGCGTATGAGGCGGAGGGATCGCCGTAGACGCGTGATTTAAAAGATCGCC
AAATCGTCAGAGTTTATGGAGGGGCTCTGATGACAAGAAGATTAAAGAGGAAGATCGATCAATCGATCTGGAAGAGAAACCTCGACCCCCTCCTGAGGTC
CCTTCGGGGACCACCGCGGATCGTGCTGCAGAGAACAAGCCGCTGGGTGAAAACCCTTCAGCGAAAACTGAACAAAAACTACACAAGACCACTCAGGCAA
TGTCGAAGAAGAAGTTGTGAAGACGGATCGAGTGAAGAAAGAAGAGCCCAGATCGGATCAACACGATCGTAGTGTGAAATCTATCAATCGACCGATCAAG
TTCGTGGACGATAACATGAAGATGGAAGGCTGGCAGTTGGACCAATTGGCGCAGGGATATCACTGGAAGGCACTCAAGAATCTGCTATCGAGCGATCCAG
TGCTCCAGATATTGAAGCCCAAGCTGATCGGAGAGATTTAAGATCCGATATCCCCACCGACGGTGACAAGTAACCCGCTGGACGGGATCAACGCGATCAT
CCAGCTACTAAATGACGCTGGATACGTTGCTGGAGTGTTAGACGCGAACAAACTGCTGGATTGCGATCAAGATCAGGTGAACCACGCGTGTCGATCGCTA
TATAACAAGTTGAACCCCCTGACGGGTAAGTGCGAATACACAGATCAAGCTGCCACTACGATCGCCGACTTCCCGAGAGGAGACCGGATCGTCGCAGTAC
GCCTCGGTTGATTCTGAAATGGAGTCGAATGATTCGGTCGGTATTCAGCGGATGTCTCTAGGCACAAGTGGGGCAGCACATCTACGCGATCGAGTTGAGA
CGATCAAGATCGAACCGCAATCGACGATTACATGCGCTAAAAGATTAATGACGTCAACTATGCAAGGACACCTGCGGACGTACCTCGATGATGCCATAGA
GCGTTTTCATCAAGATCAACGGGAACGAGCGTACTAAGCAATCTACCCAAGCCAAAGAATCAAGCCGGCAAGAGTCCAAGAAACATATACCCCAGATGTT
GAGATGGAATCGGTGGGATAGCATCGCAGTCGATCTAACATTTTCGATCGTGAAGATGCCGATCCCGACGGTTTGGGACAAGAAGAGTGGTGCGATGGTA
GCCACCACAGAGACGTTGCAAAACGGTGGTGGTATTCCCCAACGCATTCGAGTGTCAGCGATGACGGAGCTGAAGGAATTCAGTGGTAAAGATCGAGACT
AAGATCGGGCCAGAAGCTGGATCAGCAAGGTCAAGTCAGCGTTCCTGCGCGATGAGACGCCAGATAAAGAAAAGTTTTTGGTGTTCGGTGATCTGTTGAC
GGGACCCGCGCGAAATTGGTACAACCAACTGAGCCGATCTACACGGCACAATTGGAAATCATTGCTGGGTTGTTTTATGATACAGTATGGAGGGCAAGGT
GTGTTAGTGGCCAGACAGTATTACCTCGCACGGAAGCGATCCGATGAAACCTCGCTGGAGTACTTGCATCGTCTTAATGTCGCGGCCACGCATGCCAAGA
TCGCGAGTAAAGAAGAAGGACTGGCTACATCGGCCACGCGTCGCGAGCATGTGGAACACTTCATTGCTACGCTGGATGATCGCGATCTGGCAAAACAGCT
GACCTTAATGCGATTGATGGATATTGATGAGATAGAAGAAATTCTCCTTGCGTGTCACCGGACGGAGAATCGTCAGATGAAATCGTCGATGGGATCAAAC
AAATTCTATCAGCGAGCGATCGCGGCTGCAAATTCGATGGCGTCCAGCACGACTCGGGCGGTGCGAGCGATCCGCGATAAAGTAGAGAGCAGCGGATCGG
AATCGGAGTCAATTGGATCCGAGGAAGAAGTGGATCTTCGTCGTGTTTGTGTAACAACTACACCCAACCAATAAAAACCGAACAAGGATCATCGCACCTG
GCAGAAGAACACTGGTGAAGGGGAGGGACGCGATCGTAGTGGACGATCGAAGGCGTGCACCCATTGTGGATCTACCAGACACGATGATCGAGGGTGCTGG
AAGAGATTGACGTGCCAGAAATGTGGTCACAAAGGACACCCCTTTGGCAAATTTTTCTTCGTGTGTGCACCCTGCGGGGATATACACGAGAGTGGCAAGT
GTCCCATGGAAGAATTTTTCAATTTGGTCCGTAAGTGGTACGTGCCTACGAAGCATGCTGGAATGTTTCCGCCCAAGGTGGAGGAGATGTTAAACCAAAA
CGCTTGCCAGGTTGGAATCTGGCATGAGACGAGCGTTCTAGGCTTTGCATTTATGCATTTGTGGAAGGACCACGGAGAGATCAAGAGGTTAACGATCGGA
TCGATCCGATCGCTAATACACATAAAGATTTTACATTGGTCTCGTCAATATCAAGTGTGAAAAGAGTGGATGATTACGCCCGATCGCCTGTGAGGATGGA
GCACGACCTCGCGACAGGGAAATTGCGCGGGTATTGGAAATACCACACCCCCGGAAATGGTTCAAGCAAGCAAAAGCGGTTGGCAAGATCAACAATGAGA
AAGCCACGATGCTGTTCGATTCCGGCGCTGAAATGTCGATCCTCGATACTACCTTTGCTCGTAAGGTAGGATGTGTGATCGACGACAGTCAAACACAAGA
GTGCGTCGGAATTGGAGAGAACACGTATATGACGGTGGGACGGACGAAGATCAAGATCACTTTGGACGGATCGTTGGTTTATTATTTCGACGTTTGGGTT
GGTGGTCAGGTCGGCTAAGAATTCATATTGGGTATAAATTCTATGGTTCCGGCGGGCATCCGTTTGTAATTAGCCGACAGAACATTATGTCTACCTGAAG
AGGTGCGTATTAGTTTGGCAGGACGGAAGCCACCTAATCGATCGACCATGCAGGCGATCAACCTGAATAATCAACATGTGGACATAACGGTTGGCAGATC
GACAGAAGTACGTATTGGGGTTGGCCCACCTAAAGCTAAGCTTTGGGTGAGGCGAGAGGTGGCGTGGGTGCCGACAGTCACTAGTTGGCCAGGACAGATC
AAGTATTTGCAGCTCACGAACCTCAGCGATCGTGAAATAATTCTAAATCATGGAGCTTCGTTGGCTTTGTGGATGAAATCGGACATGATACCTAGATCAC
CAGGGTATGTATCGATCGGGTCACGGCGGTATACAGAATGGCAAACGCTAGCGTTTGAAGTGACTACGGAACGAGAGGAAGAGACAATGGAAGAGTATGC
AGGGCCGTTGGTGGATCATCCTGTGTATGAAATGCCCACTCAAATTCTACCCCGCCAAACGACAGAAATATCGGGGAAGAGCATGTCGCGACCAGACCAA
CAAACGACCAACGGAATTGAGAGTCAAGACCAAACCATGGACGGAAGTCATTTGACGAGTAAAGATCAACGATCAACAGAAATACCTTCTACGATCTACA
CAATCAAGGAGACTGTAGACGCCAATCGAGGACGAGATCATCCCAGTGAAGCGATCGAAAGCGTGAAGGTGATTGCGACGGAAGAGATCCGACATGGGGC
AGCTGATCCGTTTCACAAACGGTCCAGCCATTAGTCAGACGCGATCGCAATTGAAGATGGTGAGTTTCAGGAACAGGCCGATCGACTGGTCGAGGACTAC
GAAGTGGTGAAGATCGACACACCTGCAGAAGAGGAGAAGACCGTGAGGCCTCCAATGGTGATCGATGCGATCGAAACCAGGGATCAGAGTGATCGAGTTA
GAGATCAACCGAAACAGACGGGATACGAATCAAGCGAAATTGAGGATAACGGGTATGAAGAACTGATCCAGTCCATAAACAGTCCAGCCATCAGCCTTAC
GGGATTAAGAGTTACAAGACCAGGCCGATCGACGGACGAAAAAAGTGGGCAATACCAAGTTCGACGAAGAAATGACGAGAGATGAGTTAGCGTCAACACC
GATGTATTACCATGATGGCGGCGAGTTGTTCGCGGAAGATGTGGATCAGCACATGGCAGTTCTTCCCGAAGTGGTTACGCCCACACAAAAAATAACGATT
GATGATATTCAAGTAGGCGATCCCGGCACCCCAAGAACCGAGGATCAAGAGAAGTTGCGCCAAATGATTTAGAAGAGCCGGCATCTACTTATTGGAAGCG
GTAACGCCCTACCTCCTGCGGCGCGTGAGTCAGTTTGTGACGTCGACGTGGGAGGAGCTAACCAGATTGAACAACGGGTCCGACCGGTAGCACCAAAGTT
CCAAGAAAAACT