Description :
From Genome Similarity Track
Location :
Scaffold_215:24787- 27052
Sequence
2265 bases(100 bases per row)
TTACCTCCCGGTAGAGGTGGACGTCATGAAATTGACCTAGTTCCAGGAACTAAATACTGCGTAACACTGCAGTGGCCTTTACCTGAAGAACAGCGTGACG
TCATTGACGATTTCTTTCGTGCTAAGCACGCGGCGGGAATGGTGCGGGAGAGTAAGTCTCCCCATTCCACACCTACTATTTGTGTCAAAAATCCTAATGG
TAAGTGGCGTATTGTGCACGCTTATAACAAGCTCAATGCTGCCACTATCCTGGCTCAGACACCAATCCCCCGAAAGGATGTTCTTCAGAACAATATGGTG
GGATGTACATTGTACAGTGCGCTAGACTTAGTCGATGGTTATTACCAGCTGCTCATGCTAGCAAGCGATATTCTTCTAGCAGCGGTTAGTACCCCTACCC
GTATGCTTTGGGAGTGGTTCGTTATGCCACAAGGGCTGTCAAATTCCCCGGCTACTTTTAATCGTCTAGTGACGCAACTATTCCGACCTAATCGAGGCTA
TGCACAAACGTACTTTGATGACATCTTTGTCCATAGTCGTGCAACGGACGGTCGATCTGATGTGGATAATCACATTGATCATTTACGAGCGGTGCTCGAG
TGCATGCGCACGAATAAACTGTATGTAAATGCATCTAAGTGCATCTTTGGTGCAGAAGGGATTCACTTTCTGGGGTGCTTCATTTGGAAGCGAGGCCTTC
GAGCGGACCCCGCTAAGATAAAGGTCATAGTCGATTGGCCGATTCCTAAGAAACAAAAAGATCTACGTAAGTGGCTTGGCCTTGCCAATCACTTGCATAA
GTATAGTGCGAATTACGCAGATATGGCTCGACCATTATCCAATCTCCCTAAGAAGGATGTGGATTGGTGTTGGGGTAACATCGAACATGAAGCTTTTCAA
GCAGTTAAGGAAAGCTCCTTCATGCGCCAATGCTATCTTTGCTCGATCCTGATCGGCCTTTTAGTGTCGTCTGTGACGCAGCTGACTTGCCACAGGCAGT
CCTCTGTTACATACAGATGTCGATGGACGCGAACGCGTCATTGCATTCGAATCTTGACAGCTCAAAGCTGCTAAAAAGAATTATCCAGTTCATAACAAAG
AGCTACTTGCTATGAAGTGCGCTCTAGTCAAATTCAGAGTACATCTGCTTGGCTTAAAGCCATTGTGAACTATACAGATCATGCATCATTGCGCACTGCG
ACACAGTCGCCGCATCTCTCTCAGAGAATGGCTCGTTGGATTTCATTCTTTGCCGAATATAACTTCGAAGTGAAGTATAAGCCAGGAAAGCACAATGCTT
TGGCTGACGCGCTATCGCGCCGACCTGACTATGAGCTTGCTCAAGTCATTACGCTGTCATCGTCAGTCACTGGCTTAATCTGTGCGTCTTATGCCAAGGA
TGAACAATGTGTAGCTTTCCTACGTGCTCTTGGCAGCGAGGAGTTTAAAGACTCGGCATAGAATTGTCGGCACGTTTACGTGCGAGGCTACATCGATATT
CTATCGATAATGGCCTGTTGTGCTATCGCACAGATATTGAGGATAACCCTCGTATCGCTGTCCCTCATGATGAGAAGTTGAATTATCGAATACTCTATGA
GGCACATGATACCGCTTTAAGTGGTCATCTCGGTCGTGAGAAGACCTATAGCTCAGTGAGCCAGGCTTATTGGTGGCCCAAACTATACAGGTGGATGAGC
ACCTATGTGCGTACGTGTAAAACGTGTCAACGGGTGAAACCCTCAGCACATGCGGCGGCGCCGCTGGCTAGTCTGACTGTACACTCTGGTTGTTGGGAGT
CCATCAGCATGGACTTTGTGTTTGGCCTACCGAAAGATTCGAAAGGCAACACTGGCATTGTGGTCTTTGTTGACCGATTGAGCAAGATGGCTCATCTAGA
GGCAGTGCCAGACTCTATTAATGCAGAAGGTACAGCAAAGCTATTTATCAACCTTGTGTTTTGACAACATGGCTAGCTTGTCTCTGATAGAGATCCCCGC
TTCACTGGGAAGTTTTGGAAGTCCATCTTCAAGGTGCTCGGCACCCGTTTGGACTTGTCCACAGCGGATCATCCGCAGACCGATGGTCAAACTGAGCGTG
TTAATCGCGTCATTAATGACATTTTACGCAGTGTTTTGCGCTGATAAGCCTATGCGTTGGAGCTCCATGCTCCCTGTTGTTGAGTTTGCGTTGAACAACG
CTGTTCATGCCTCGACAGGCTATACTCCGTTCTACGTAAACGGTCTCACTCACCCTCGCGTTCCG