Description :
From Genome Similarity Track
Location :
contig_14:247844- 249539
Transcript NameFunction/comments
g2951.t1hypothetical protein F441_15031

Sequence
1695 bases(100 bases per row)
GTGGGATCTTACCTTGGACTTCCATTATCGATCTTGGGTGAAGTCAACGGAACTTGGGGCTGGACGACGACAGAAATGCGAGCCTTCATCCACCGCATTC
AAGAAATCACCATGGAAGAGAACGGCGGTCACCCAATGATCTTCGGTGTGGATGCTGCTCACGGAAATTCACTTCTGTCAGACACGGTGTTCTTCGGTCA
CCAGATCAACGCTGCTGCCACGTTCAACCCGGACATTGCATACGAACAAGCTCGCATCACTGCACGTGATGCGCTAGCTGCTGGCATCCCTTGGGTCTTT
GACCCCGTTCTCGACATCGTACACAACCCGCTGTGGCCGCGCGTGTACGAGACGTTTGGTGAGGATCCGTACCTCATTTCCACCATGGGGGTCGCCATGG
TCCGTGGTATCCAGAGCTACAACGAGTCGGCCGCATGCATGAAGCACTGGATCGGCTACTCGTGGAGCGCGACTGGCAAGGATAAGGACGGCGTGGAGAT
TTCAGATTATGACCTCATGAACTCGTACTTCCCGCCGTTCAAGGCCGCTGTGGATGCAGGTCTGTTGACTGGAATGGAGAATTACATTTCCGTGAACGGT
GTCCCTGTGATCGAAAATACGAAGCTGATGACGACGTTGCTGCGCGAGGACCTTGGTTTTGATGGTTTGATGGTGTCGGATTATGGCGAGATCAATCAAC
TCACAGAGTTCCACCGTACTGCTCGCTCGACCGAAGAAGCCACCAAATTCGCCCTTGAGCGCACGTCACTCGATATGAGTATGGTAGGCAGGAACCAGGC
TTTCACGAATGCAACCAACAAATTGATTGAGGAGAGTCCGGAGATCATTGACCGCCTCAAACAATCTGTGCGGCGCATTGTCAAGACGAAGCTGAAGCTC
GGCCTCTATGACAACCCGATGCCTGGCGCGGAGTACGTTGACATGGTTGGTAGCGATGATGACGTCGCCGCCGCGTTAACTGGAGCTCGCGAGTCGATCG
TATTGCTGCAGAACAATGACAGCACCCTGCCTCTTTTGAAGAACGCATCAGTATTTCTGACGGGCCCCAGCGCACACAACATCGGATACCAGTGCGGTGG
CTGGAGTCTCCAGGTATGGGGAGTATCCGGTAACGACATGTTCTCCACGGTGTTTCGGTGAAGCAGGGCTTCGAGGTAATTGCTGCAACGATTCGTTCAC
TTACTTCAACGGCCTGAATATAACGGGTAACTACACGGATGTGGATCTGGCGACTGCAAAGGAATACGCCAGCCAAGCCGAATATACGATCGCAGTCATT
GGCGAGGAGCCGTACGAGGAGAAGTCGGGCGATATCGACGATCTCTCGCTGCCTGCTGGTCAAATTGAGTACGTGAAGGAGCTGGCATCGACGGGAACTA
AGGTCATCGTGGTGCTGTTTGAGGGCCGTCCGCGTCTGCTGGGTGGCCTGCCGGAGAACGTGTACGCCATCCTGAACGGCATGCTGGCGTGTGAGCTGGG
TGGTCAAGCCGTAGCTGAGATCGCCTACGGTGATGTGAACCCGAGTGGCCGTATGCCTATCACGTATCCCAAGGACTCTGGCAACGTCATGATCCCGTAC
CGGCACCGCGTGACCACGCAGTGTGCGACGGGCGACTACTGCGAGCCACAGTGGACTTTTGGCCACGGTCTCAGCTACACCGACTTCACGTACTC