Description :
From Genome Similarity Track
Location :
Scaffold_335:24781- 26585
Sequence
1804 bases(100 bases per row)
CCATTTTTTAATCCAATTGAGTACATATTCGGCTACGTGAAGCAGTCATTTCGACGACACTATGTGTGACGGGGTCACACAGCACCTTGCGCTAGAGGAA
GTTGGTTTCCGAGAGTATACAAACTCTCAGTGAACGGCAGTTCACAGGTTCCCTTCTATCGAAAGGGAGCGAAGTGACCAATTTAAGGTAGAATGTAAAC
TGAGTATATTTATCGGTAGATAAAGCTTGAGCTAAATACAAACTATAAGTCACCTATAGAAAAGCAATGTCATCAGCCAATGGTTGGCTTTGGACGCTGT
CGGCAGACCCGCAATATCATGATTTTCTGCTTGCTCTGCTAATCAGGGCGATCGACGAAGTGGTGGCGTGTGCCTCGAGGTCGATGGCACATGTGGTCGA
GGGGTGGGCTCTCTAGGAGACGCAATATCTTCATCTGCAATGTTGTGCGGGTTCGGGAGTCGTGATGATCTTCGAACTGGGGGAGTATAAGCTGCGTTGG
AGCTGTAAGCTGACCGAGGTCTTGCCGTTGATTGCGTCGACTGAATCGAGACTTCTGTCGAAACACGAGGAGTCCTTCGTCCAGCAGGACGCGGTAAATA
CGGCGAAACTGGTGTGTGCGGTGATCTCTGTCGGGCGCGCGCAGGACTCGATGACATGATGTGCTGGCGGGTCTCCTTGTAGACTTTGTAAATACAGTGA
TATTGAAGCGGCAGCCTGTGAGACACTGGCAACGTCGTATTCGCCTCGAGAGCCACGATCAAGATCTTCTCCGAGCACCCCAGGCTACACAGCCTTGTCA
CTTTCAAAATGCATAAATATATTCTGTATTGTAGATTCGAGATTCGCCGGCTGTTGGTCATGAGCGAATAACGAATCGCGGACGGAAATTTTAAGTAGAG
CTCACAATAGCAAGCGAAAAATGAAGCCAAGCAACAGTACCACTTTTACTGCGCACACTTTTACTGCGTACTTTTGAAACAAGTTTTATATTTTTAATTT
TTTAAAAAATGTGGCTCATCATGCAAGTTGTCGGTACCTACATACTTCTGGTTGTTCTCTCCATATTTGGATGGGCGACTGATCGAGTCGAGCGTGAATC
AATTGCGCGAGCCTGCTAAATATACTTTTTGTACGATATGATAGGTTTTGCTCTCCGTGTCAGTCTTTATGCCAATATCAAATCAGTATAGTTTCAGTTT
TTACCCAACATTGTAGCAGAACCTGCTACAGTGTCGCCAACTTCATTATTCACCCCACCGCACTCATTAAAGCAACTTTAGTTTGAGCAACTTCAGCAAT
TTGATTTAGGCAAATTGCGGCACCTTCTGCACCTTCAGCAACTTCAGTGAAATCGGACTTTGTTGTAAAATGTACGGTTCACCCAATCGGATAGCCCTTC
ATTCCTTCACCGCATTTCCGAAAGCTTTGAGCGAGGCGAAGGACTTCCACGATCGCACTCGTTAACGCAACTGCAAAATTGATTGTTGCGCGACTTCAAC
CTAATGTGTATTTATTTGGGACCGTAATTTATTGTGAACCGGTCCTGCACTTTATCTGAGCCGACCACGCAAATCGTTTCAGTAAATGACAAACAATACA
GTAATAATAGTTAGCGTCTTCTAGGTAACAGTGAAAATTTCAGTACGTGCCGATGTATCGACGTGGTAACTGCGCCCATCACCGGCCGACACAACGAACA
TGTTTGACGTGACTTCACTGACATTAGAGTGCGTTGCGCGGTCCTTTGCCGTCCAGTCCTGTGTTTTAACCTGGCAATAGGCGTGCATGCTGACCTCTCG
GGAT