Description :
From Genome Similarity Track
Location :
Scaffold_231:2478- 3941
Transcript NameFunction/comments
Phypl_g5667hypothetical protein

Sequence
1463 bases(100 bases per row)
ggcgctgctcactcgctgattggctggatTAGCCACAAGAGGACCCGAGGATCAACACTCGTGCAAACCACGCGTAATGACTGGTAGTCCGCCGCCTGAC
CCCGACTGGGGGCGGCACCAGAACGGGTCACCGACGTTTATCGCGTTCGGAACCCTCTGGTGCCGGATGAGGCAGCAAGGATAGCACGAGCTccatcgag
gacgacgcgggcCAACACCAGGCATGGCCATCACGCAGCGATGATGGGCCAGTTCAGGCATCTCGGAAAAAAGGGGGCGACAATCCGGTGGATAAAAGGG
CCAGTCTGGCGGACAACGCGGCAATATTTCGGCCCAAGCGGGCAGGGGCCTGGGAGGATGGCGGCGCGGAGCGGCTCAAGGCGACCCTGCTGCGGGACTG
GACGACTCCTGATTTTCTGAAGGGGGCTGAAATGTCGAAAGACATGCTAGCTGAGGCTCCCAAGCCTTGTCTTCTGCGTGCGGATACACATCTGCGCAAG
ATGACAGTACGTGAGGAAAATATCCTACAATAGTATCTGAAGGGAAGGCTAGAGCTACCGCATCCCCCATTTTCATCGACGAGGTCCTGCCATCGTCCAG
CGCACTCAACTCCGATAATTCCACGACCAATATTTGATGTATCGGCTTACAGCCACAATTCCGCCGGAGGTGCGGCTGCCAAAGGGGGTGGCTCAACGCA
CCATCATGAACTTGATATTCGAGGCCAACACCAGCTCGAATGTTGATCAGAACATGATGAGACGACTGCTCGCGGGCGCTGAGCGCATGACCTTTGACGG
ATCCTTCGTCCTTACATTTGTGTTTGCCTCACACACCCGGGCAAGGCCGTGGGTCAACGCAACGCTCCGTCTCAAGAATTCGTTGATCATGTTGAAAGAT
ACCACAGGGTTCGAAAGGGCCACTGCAACCGGAGAGATGACTATGGACCAATTGGCGTTGTGCTACGAGATCAAGGTGATGAATGCGGGGTCGCTGGGAG
CGACGGCTCTTCTCCTTGCTCTGCAGCACATGGCCGGGGTGCCTGTAGCGCAGGTGACGAGACCAACCGCAAAGGCAGGACCTGCCGCCCAGGATCGGGA
TCACTGGCTGGTTACTTTTCGAAGCAACAACTGCCCAGCCAACTTAAGCGGTGTCACTTGCGTCATGATGGAGGGACACGCAGtactgctgcaccaccat
cGAGTGCATCTGCGGATTCTGTGTTTCCGTTGTTACAGCCAAAGGCATTCGGCGACGATTTGTAAGACTATCGAGGCTCGAGTCAACAGTTCCAAGACTA
ATTTTTCTAGGACTTTCACTGGTAAGATCAGCTCAGTCCCCACCATTAGCCCAAGcaaagcgcaagcagcaacggtGGTGCAGTTCACGGACATGCTGCG
GGCAGCGGCGGAGAAACACCTGCAGTGTGACGCCCAATCCAGAGAACGGCCGCAGGAGTACTC