Description :
From Genome Similarity Track
Location :
Scaffold_51:24775- 29151
Transcript NameFunction/comments
g4387.t1ETK91253.1 hypothetical protein L915_05130 [Phytophthora parasitica
g4388.t1hypothetical protein

Sequence
4376 bases(100 bases per row)
CGGGATACTGAGTTTTGGTGCGGAGTCAGCATTGGCGTCTTCCACATTTCTAGTCTCAGTTTCGTGTTCTTGTCGACTCAAACGCCCATTTTCCCCTGAA
GTGCCTACTTTTTGACCCAATGCATGCAGTTGCGATGCAATTTCACTGTTCACCGCTCGGAGCTGCTCCATATTTTAGATAATATCCGGGGATTCGTTCC
CGAAATCGATCGGGGGCCTGCACGCGGTTCCAGAGGCCTCGATGACGCTCAAAGCGCGCGTTATCGTGTCGAGAGCAGGGTAGAGCTGCGTCGAGGCGCG
CTGAATCTCTTCATGTAGCGCTGCGATGCACTAGACGCGCAGCTCGGCGGCGCTGAAGTGCGAGAGGATCACCTCCATTTTGGCTATTTTGCAAAAGCCT
AATTACTTTTGGGGAAATTGATATCCGAGTAGAATACCAATTAAAAAAAACGCAATCTGCGAGAGTTGACTCGGTGGTTTATCGCAGTCGGATGAGTAGG
ACGCAGAGGAGGTGGAAGTTAAGGGACGAGCAGATGGGAAACACGTTTCAGAGTGGAGCTTTGGAACTGCTGGTGGGAGGATGAAGATACAACAGTCAGA
GGAAACTATTGCTGCTGATGAGGAAGAAACCCTACGGCCGATTGGAGAAGAGCAAGTGGAGCAGCCGGATATGGATGGGAATTCAATTACTGGTGAAGTG
GTGGAAGTGCCAATCGTTTCTGGGGACGAAGAACAGAATGCATCAAATGTGAATGTCGTCAGGATGCTCACTCACTTGCTGTTATGCAGGGTACCTATTA
CTATTTTGAATTTATTTCTAAGCGAGAGTCGTCCAGAGCTCGTTTACCTTAGGGAACTCTAGTCCCGTTAGACGTCATGTTGGTCAGACGGGTGTATCTG
CATGTGACGCGCGTTGGTGATAACTCGTCCGGTACTACTACGTGCAGTAGCACCTGGCATGCTGCTAATCAGTATCTGCTTCTGGTGCCGCTATTGTTTG
AGGACGAGTTGTGCTGAGCACAGCGAAACAGTGCACAGCCGCATGTCTCGCACCAACAACAAACTGGCGGCGTGCAACGGAGCCGTTGGGATTAACTATA
GCATGAAAAGCCCGAACGATAATAGCCTGATTTATGATTGAAGCAAGCGTAGAGCTCTTATGACAATGGTGTGATCCTAGCATCTGATGCAGTGTGAAAT
CAGCCGCAGTGTTCCAGTATTGTTGTGGCGTTTGTCCCGGCCCAGGGATTAACAAAGCACTACAAAAAACTCACTCTCCAATTTGCGGCACCTCAACTTC
GACGTAAAGATGGAAGACAAAGACTTCGTCGACTTCTCCGAGTCCCGGCCAAAACTGAAGCCAAGCATGTCCCAAAGGGCCTTGACCTCCGTGAACAAAA
CTCTCCGACCGCCCGATGGCACACCACTCACGCGCTTTATTAAAATGATGCACCGCCTAGCAGTATTCGGCGTTGCAATTCTGTACGTCGAGATCTCGCT
CCATTCTTTCTCCACGGCAATGTTAATTCTCCACGGTTCGGTCTCGCATGATTTACCTATCGAGACGCACACATCCAGTTTGATCACGGGCTATGCCGGT
ACCACGACGATCCAACAGAGTCCTCTGGTTCAAGAAGTACTCCAAGGATCAACAAGTCCACGCAATGACTCCTTGTACCTCGAGACGACTACTACGCAGT
CTAATACCGGGTGTTCTGGGGTACCGGGTTTCAACGTCGAGGTTTACAGCAACGAATTTTTGCGCTTCATTTTTTCAAGACTTCAGATGCATGCTTCTCA
CAATCTGTCATACCTGACGGAACTTGAACTGGTAACGCCAGTGATCGACTGCACGTTCAGTCTTCTTACATCGGCAGATCGCACTTCTGCTCGCGTGTAC
TACCTCGCGCGTCAGCAAGGTAACTCAACGGACGTGGTTTTGCTCTCAACGTCGCTGTCTGTTCAGGACTACGAGGTGGACAAACAGTTCCAGAGGGGGC
CTGCGCTGATACTTGTGGTCGCTGCTATCAACGACTTGCGCACTACGACTGTGGATCACCAAATCGCAATTGCGTTCAACTACCCGTACGTGGCAGAACC
AATGTTTGCGTACTCAGAGTTGAGGGGCATCGACAGCGATAACTTCTGGCAGCTCGAAAGTCTGTCGAACCCACGCAACCAAGACCCCGCCAAGTCTGTT
CGGATGGCTCGCCGCTTTGGACGGTACGTAAGTGACCCGACTGCGCAGTCAAACATTGAAATGGCCCATTGGGACCTGTCAACAGATCCGATCACCGAGC
TGAGTAGCTGGAGATGGCACGGCCGGGCTGTACTCCACGACTCGTGGGCCTGGACGCATGCAATTCACGGCATCTTCGCGCTCAACGTGATCTTCAACCT
GTTGATACTGCTCTTCGTGATCTATCGGCGTGCGTGCATGGGCCACTTTTGGGTGGGGGACGCCTTCTCCACGATCTCCAATATGATGTTCTACAGAGGC
TTGATCGTCCTGGTATGCAATCATCTGAACGGCTACTGGACGATCACGAAAATGTGCATCTCGATCGGAGACTCCATCGCAAGTCAGCATGCCATTTACT
ACCGTCCGGAGCTAGTGCATGCGGATCTATTGGCGGTGTTCATGAACGTGACAAGTGTGCTAACGTACCTGGGACGCGAACGCGTAGATCCACTACTAGC
ATTTCTGACATTCGAGCTGAGCTGGTGGAATCGTGTGGGGCTGGCAAAATTATTCCCCGGGTTGAGAAAAGAGATCGCACGTTTCGCTGTGGCTGACGCG
ACAAATGGGCTACTGGATGTGAGCTCTGGCCTGGCGATGCTCTCACCGATGGAGCTTATGACCGCGTATCCTGTTGAGGAGAGTCGGCGGTCTGTTGTCT
TCTCAGCGGTGGCTTCGATCTTTAGTCCCATCGTGCTGATAGCCGCATACGTCGCACTACGAAAAGCGGTACGGTACGTGAAGTCCCCGCTGAGTGGAGA
TAACGACGCTTCTCGTCGACGGTCAAGCGCTTACACGGAAGAATCGCAGCAGACCGACCTCACATCTTTCGAGACGGCAACGGGTGCAGCACTGAGCAAG
CGTTTTGGCGTGCTCTCGAGCTATGACAATTATCTGGCATGCGAGAGCCAACTCACCGCCACAATTGATGCAGTCTACGGCAATGGATTCCTCGTTGTCA
AGGGCAAATTCTTGATTGGTGCCCAAGATCTGCTTCCTGTGATCCTGATGAAGCTGACCCGCATCCGCTTCACCAACATTTTTGTGTATGAGATCACGGA
GAAAAATTCTGTCAACGAGACAGCACGGCTCGTGTACCCAGCGACCATCTCGTGGAACGACTTGGGGCATCTCGACGTCACCCCTCTCACGTAGCTTTGT
TCCAAACATAGTTAGTAAACCAACAGCGCCAGGAAAAAACATATATCTTCTTCAACTGTAGCCACAGTTTTGGTTTAGTCAAATAGCTACTCGTTTGCCT
GCACGTCCCAAGTGCAGAAATGGACACAATTCTCTCGCACTTCGGGGCTGACGAGCTGCGTGACAAGTGTACGGTGGCAATTCAAGAGGAAATCCAGAAT
TCTCACACTAAACTCGGACCCGCGCTCGATGCTTTGAGTAACGCGTTAGAAACTTCCCGGAAACTGCACAAAGCTTTGTTGCGTTGTCTCTAGACGTGGC
ACGGGCCTTGGAACAGCTTGCAGCTACGTCCAACGAGATGGATTTGTGAACTGAATCAAGAAACACGAAGCGACGGTGCTCCTCATCCGAAACAGAGAGC
GAAGACATCCAAGAATTCGGATCAGGCGATGTAGTTGAGCAAGCGGCGAAGGCAGAAAACAATATTCCGGGGCCTGTGCATGGTGGTTCAAGGATACTAC
CTCATCGGCTTCAGTTGATTTGGAGGAGTGATGTAAATTACGTCAAAACGGAAGCCGTGAAGCAAGAATCCGTAGGTGATGATACAGCAGAATCGCTGGC
TGAAGATGCGGGGTTGCTCGGAAGCAAAGAAAAGAAACAGCCCTGCAAATCGAGGTAAATTGTGAGAGACGCAATCGCACGCTTATACAACTGGGACGAA
CTGGGTCCGCAACATGATGCGAGTTATTTTGTACGCAAAACGGCAAGATGTCCCGATCGGCCATCATTTGGGTGGCTGATGTAATTTCCGAGCTGCCAGG
GCTCCCAGACGAATATTGCCACAAAGGATTTCTTGACCAAGCGAGTATGGAGGATCGCTTCAACCACGTTTTAAGCTACGCGGAATGCGCATACTCTGTA
TGCTCTAATTCCGAAGCTGGAGATAACGTCCAAGTTTTGGGTATCGCATTGATCGACTACAAAAGCTTTTGGACAA