Description :
From Genome Similarity Track
Location :
Scaffold_1208:2477- 5440
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_1208-snap-gene-0.0Reverse transcriptase

Sequence
2963 bases(100 bases per row)
GTTGAGGTCGGCCTCATGTACCCAATCCAGTGTATCATACCCAACCCAACGAACCGAATACTCGCGCACTGGTCGCCCCTGGCGTGCCGCCCTTCGGTCT
CGATGATCCACAATCGCTTCGACTTCGTACTCATCAGCTTCGGCGTCTGGCTCGAAAGAGTCCTCGGGCAACAACGCTTCGTCAAAGTCAAAACGTTCGG
TTGTCTCCGgCTCGACTTCTGGACGAGGTTCGAACTCACGCCACAACTTCAGGCGACTCACGTGTACCAGTGGGAAAAaTCGATAACCGGTGTCGTCCAA
CTTCAATTTGGCTAGGTGATGGTCGGGCCGCTCGAGTACgcGGAAcGgACCgTGCCACaGGTGCGCtAGCTTCCTtgCAaNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNcTATGTACATATCaGGgACCGgACTCAGTCGGCTA
AGGTCGGCTGAGTTAGCAGCTGGGCcGCCTGTAGAACCTTCTCCATCCCcATCTCCCAaGTTGTGGCTCGTACGGTGACTTGTAGGCtGGTTCcGGCCAG
TCGTGTGGCTGTAGTCACCCGGATGGTTACCGACTGGGTCTTGCGTCTCGTTCAGCACACTTCTTGGACTcACCCCTTCGCCCATGTCTGGgACCGGGCt
cTCGGGAGTTGGCAGCGATTGCCGCACACCTTCAACCGCATCTTCAACCACCGTCCTtCGTTCAGACCGAGTCACCaCCATTGCCGCAGCGGCGTCGCCg
CTCGGCgCCAAGGAGCGCAGCACCTCAGATAGGCGATTGAGCCGCTGCAGGTCGGCGAAAGCATCTGCTGACACACTCTCGCCGCTACCACGTTGTAACG
CTcGCCCCcTGATCAAGTCGgCcGCGGCATTGAAGGTCCGCGCGACGTGCAGCAGATGCGCGTGCTTCAACTTGCCGAGTTCAGCGATAGCTTCTGCATG
CAGCACCTGAAGGCCAGGcGACTTAtAGTCGATCTCCCcAcGcAGTtGCTGGATGACGATCCTGGAgTCGCCTACGACTACTAGCTCTTCAACACCAGAC
GCGAGTGCCATCTTCAGTCCCTCGATCACGCcGCGGTACTCGGCTTCGTTcACCGTTCcGTCCTCGAAGTACCAGGAGGCAGCCGCCTTAACGCCCCAGT
CGGgTAGGTGCCACAGCACAGCACCGCAgCTCGCACTCGCTCGCTTCGTCTTAGCTGACCCGTCAAATGACAGTACCCAGGCTTCCTGTTCCCCAGTGAT
TGTCGGCAGTGGTGTCCGATACTtGGcATCAAGTGCAAGCTtCTtCcGtGGTCGGATTtCTTGCAGCATCTCATCTAGGCGGTCACTGGgACCGgCAGCC
GCcGCCATCAAACCcGCGAGCTCGtCTTCGCCGTGAGTCGCCTTCCGAATCACAaGCGACCACTGGCCAAGCATAGTCGCCCACTTCTCCAGGCGACcTT
GAAGACCTTTCGCCTGAAaCAGCCACGCCATCGTCGAGTGTCGCGTGAGCACATGCACATCCCGCCCAACCAGCATGTTCGCACCGCCGGCTAGGACGTG
AAGTAAGGTGACTATCTCGCGTTCGGCTGGGGTGAACTTCAGCTCGTtCGGTTTCAAGACACGGCTGAGGAACCTGACCGGCATCAGCTGACCGTCGTGG
TCTTGAAGAAGTGTGCCAGCCACCGCCcAGGCGTTTGCGTACACGGCGACCACAGCTTCTTTAtCACCATCGAAGTGACGAAGTACAGGCGACTTGGCCA
GTTTCAGCTTCAGCTCCTCGAAGGCGCGCTTAGCGGTGTTCAGGTGACCCGGATTCGTGGTCTCCTGAACCAGGTTTGCTGGaGTTACCTCGTAGAGAGC
CGCTGCGTAAACGCCAAAGTGCTCAATAAaGCGATGGTAATAGTTGAGCGATCCCAAGAACGACTGTATCCCCTTGATGGTGTGTGGGAATGGCAGGTTC
ACCAGATCTTCCAAGTTCTTCGGCTTCGCGGTGATACCTTCGGGCGACACAGTATGTCCTAGGTAATCGACCTTGCTCATTCCAAACTCACTCTTGGGCA
GACTGATGGATAACCCCCACTGTTCGCAAGCAACCATGAGCCGTTCCAGCTTCTCGCACATATCATCTCAGGTGTCACCACCGAAGAGGATGTCGTCGAT
GCATGACCGTCTACCGATGACCGGGACAACGTCGTCTCCAGCCGGCTCGCCGtCCTTGAAGATGTCGGCTTCGTCGTCTCGCAGGAGCTTTGGCTTCAAG
TTCAAGTAACCGTAGAGGCGTTGCCAAGCAGCCGCTGATATATCTGCGGCGCTTTCTTCTACC