Description :
From Genome Similarity Track
Location :
Scaffold_604:2477- 4013
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_604-snap-gene-0.6Sodium/hydrogen exchanger

Sequence
1536 bases(100 bases per row)
GCGGCAGGAATGGACGGGTGGTGAGCTGCTCGTGTGCGCGCTGCTGGAGCTGCTTATCGTACGCATCGCGTATCAAATCGACCGAAGCAAGACGGCGCCG
TACCTGTCGACTGCTGCCTGGGCGATCGTACTCGGCATTGGGGTTCGNNNNNNNNNNTTTTGGCTTTGCTTGCCTTTAATGATTGAAAAACTTATGTTTG
CGACTCGCTCATGTCTGTAGTTTGGCTTGATGCTGTCGCTGATATCAAAGGACGTACGTTTCTCTTCGTCATGTGCAAGTATCTCTTGTCACTATGCTGA
CCAATATGATTCCATGTATCGTATATTTTGAAAAAGCGCGCGACAGACATCGGTTTGGATCCCCAGATCCTGTTCTTTGGACTTTTGCCGCCNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNTAGAAGGCGGCTTCAGTACACAGCACCGCGGCTTTTTCGCCAACTTCTGGGACGTTTTCCTGCTCGGTGTCGTTGG
TACGGTTGGTGCGTCCGTCGTCACTGGCGCGCTGCTATACTGGCTCGGGCGCACATCGCTGCTCGCGATCGCGTTCACGCCCTCAGAAGCCATGCTCTAC
GGCGCGCTAATCTCGGGAATTGACCCGATTGCGACTCAGCTCGTGCTTCGGAAAAGCCATGTGCCAACACTAATTCCGGAACTCGTCTTTGGCGAGCGCT
CGCTCAACAATGCCATCAGTAAGTTTGCATTGCTGTACAACTCTCGTCGAATGGTGAGGCTAATTTACGTTGGTGGATATGGCTGGTAAATAGCGGTTGC
GTTGTTCAATCTGTGTGAAATGCGCGTGCAAAGCGGCAATTCTGAGGTGACATTTGCAAATGCGATGAATCTGTTTCTCGAACTGGTCGGTGTCGGTGTC
GGGTCGCTCGTGCTTGCTNNNNNNNNNNNNNNNNNNNNNNNNAATCGTCGGGTATTCGTCAGCGTATCTTCTCCGCGTAAGTCCATACTTGCATGATTAC
ATAATTGGAATATATATTGGTATAATGACAGGTTGTTGTTGCTTTCGGCCATCCATAGCGCTCGGACGAATTGCTCCGACAGCACCAAGCGTACGAGATC
TCAATTTTGCTGCTCTTTGCATACGCGAGTTACTTGGCGGGCGAGTTTTTCCACTTGAGCGGCCATTTGGCCGTGTTTTTCAGTGGCGCGTTCATTCGCC
ACTACCACGTGTACAGCATTTCCCACGCGAGTGCGACGTCGTTCCGCCACTTACTGACCACGCTGTCGTTCCTCTCGGAGAATTTCATCTTCATCTACCT
GGGCGTCAGTATCTTTGCATGTATGTGCAAGGTCCTACCTCTGTGTGCACTACTGGTCTGAACGAGGTATGGAAACTAAATCATGTGGCTACTCTTTGTA
GACTCGGGCTCGTTTGAGTGGGAGTGGCGCTTCATCCTTGTGAGCTTTGTCGTGTGTCTCATTGCGCGCGCATTGATGACGTTTCCACTGTGCTATGTTG
CGAATCTGTGGCGATCGCATGCAATCCCGTTCAAGT