Description :
From Genome Similarity Track
Location :
scaffold_169:24763- 29568
Transcript NameFunction/comments
Pl_108368hypothetical protein PHYSODRAFT_536754
Pl_108369hypothetical protein PHYSODRAFT_308312
Pl_108370hypothetical protein PHYSODRAFT_471396
Pl_108371hypothetical protein PHYSODRAFT_477669

Sequence
4805 bases(100 bases per row)
GCTCGTGACTATGGTAGGGCGTGTTGAACACACAAGTGGCGTCATCCCAGCAAGCTGAGCTGCTGTGCTTGTTCCTCCTGCCATCACTGGCCTCGGAGGA
CGTGTCCCAACTTTCCAGTGGAGCAGACTCCTTCCTTCAGAGCTCCGTATATAGCTCCGTGTCGTCGGTGGTGATTCCGCACACGACACGCACGAAGGCG
CTTCTCCCCGAAATGACGAGCGCCAAGCCTCACATTGTCGGAGTTCAAGATTTGGATGTGTTTATTACGTCCGCGGAAGGAAAGGCGCTGTTTACCAACG
GCGAAACGGACTTGCTGGTTGTGCAATTGCCGGAGTCGATGTCGCTACCAGATGTAGATGCCGCCATCCAAGCAGCTTCGAATAGCCTCAGTACAGCCAC
GGACGGCAAGACGGACTTTGCCTTTACCGGCAATGATGCCAACTCTGTGGAGCTTAAGGACCCGCTCGCGCGCCGTCTTGCTTTGCAAGCCAAGACCAAG
AAGACAAACTCTTCAACTGAGGCTGCAACTCTGTGCGAAGCTGGTTACCTTCTTGGATACAGTGCGTCTGGCAAGGCATTTTGCTTTTCACACTATGTGA
ACATCACTCCCGACATCATGGCAGGCCTCCTTTTTGGTCTTCTGTTCATTTTTATGGCGTACATCGGTCTGGGTGTGCTCCACCAAATTCAAACACCGCA
ACGATACCCGTCGCAAGGTGCCCCACGCGGCAAGGAGTTCTAATGCGGTGGCTATGGCCTTGAGCATCGAATTGAGAGATGTGAGATGCATGAAAACGAA
AGATTTATATTCCCCTTGGTTGAAGGCTGAGTGAAGTCTAATAGTGGCTAGTCTACACCTTGTTACCGCTTGTTATCCTGCAGTACTCGAATATGCAGTG
AACAGCCTGTGCATGGCACCACGTCCATGCCATCCTTCAGCTCCTCATCCGTGATCTCGTACAAGTCTCCGCAGCGACATTGGTGAGTGAAGATCACTTC
GTCTTCATCGCCGTGCTCACCCTGCAGGACCTCCCGTTGCATGCCAGCCAGTAGGACATTGTCGGATACGACCACGACCTCTTGCTCCCTCTTGCGCACC
AGGTCATCCTGCTGCAGTTTGGCGTCGTACTGCCGCCTCAGTTCAGCACTGCGCAGTGTTTCATAAGCCTCTTGCACGCGCAGAAACTGCTGCTCGTCCT
CAAGTACTGAGCTACTTATCTCGTTCGTACTCAGTCCATTCGACCGCTTATCCGGGTGATATTTGCGGGCTGCTTGGTGGTATGCCCTGCGGACGTCGTC
AGTGCTGCAGGAGGCTGCCAAGCCCAGCACCTCGTAGAACGACACGCTCATCCTTGCCAAGCCAATAGTCCGCCCTCGCGCTTAATTGCGACTTGGCATC
CTATCCAGTCTGATTACCACTTTTTAGCAGCTCGCCACAAGGACTGTGCGAGGAACACACCACCCTACCCCTGCGTGAGTGATAGTGAAAGGTTGCACAA
GTCTCAGACAGCAGTTCGCATCGCAGTGTTCTGCGCTGTCTTCTTCCTCCCGTCTTCGCAGTTCCTCTCCGTGTCTCGACGCGTGTGATCCGTCGCGTCG
TGAAGCTGGCGCGTCTTCTCCTCGTGGCCGATGGAGCTAAAATGGTGCGTATTCCGTCTCAATAGTCGTATGTTCAACCTGCAAGAACAGTCCTTCTCAC
TCGCTCTTCCTCTGTGCAGAGCCTTCCTACGAACGGCGGGACTAATCGAGACGCCTTTGGCTCTGTGTCCACCCACCCGATTCCGTCGTTGTCGCGTCCA
CCGTCTTACTCTATCTCGCGCTCGCAATTCGCCGGTAATGGACTCTCTCGAAAGCGCAGTCACAGCGGCGACTCGCTCTCGTCGCAGTCTTCCGGGACGT
CGTCTAGCATTACATTTGCTGCTCCTCGCATGTCATTTGCGTCACCTTCTCTTCTGAGAGAATCTCCCGCCACCGTATCGACAGCAGAAGGTTCTACTAT
AGCAGCAACATTTCCACTTCTCAGATGTCAAGTACCAGCCCCACGACAACAGGCAAAGCGTCTACGCCGTGAACCACGGAGTCCGACGTCAGTGGGAGAA
GTCTCCGATACCAAGAAGATGCCGCCTGCGAAGACTGCAGTAGTGACGACTCCTGGACTTGCACAAATGCAGTCGGTGCTTCGTGGACTGCAGCATCTAT
CGACATGCAGCACCAGCGGGTGTCCCAATCCACTGTGTGTATCTACGCGCACTTTTGTGGGTAAAGTGAAAGCCCATCGCTCGAGCATGGCAGGCCAAGC
CACTCATGATGCGAACAAGTGTGGCGCTTGTAAGCTCTGGGGGGCCATTGTGCGGGTGCACGCACCTACGTGCTCTGCCGGCGCAGCATGCTGCGTGCCA
GGCTGTTCTCCGTAGCTACGATGTCATCAGCTGGAATAAACTGTGAACGAAGCAGGAAGTGTTGTGAAGATGGCGAGCTGATATTTTCGTCACTATTAAA
AATGTCTTGTTAGCTGGCGGTTGTCATGTACAGAAGCTCTTCCAGCATTCTCTGAGGGGCTATTTTCGTTGCGCGAGTATGGAGTCTAAACCGGGGACAG
AGCTCTTTGCTGAACGCTCACAACCGTTGCAGCCTCTCTAGAATCAGCGAAAACGTGAACGCATGCACAATGGTGCTCAAATTCTGCAGCCCTCCATGGA
GTGAGGAACCTGGGTCGATGCTTCCGAGTAGCCACAATTCAGACGAGGACGAGGCTACTGCAATGGAAGGACGGCAAGTTCGTGCGGAGAGAGCGTGGAA
TGACCTACTGGTAGCCACTTTTCGAGCCAAACAGAAGGAAGAAACTTGTCAATGGGAGAAGGAGTTTAGCGTGTTCTTCGACGACAGCAAGCCTGTGGGT
CTTGGTTTCCAGCCCTCATCAAGGAGTAACAAGTTAACCCTTGTACCTGCCCTAAGTTACACTTGCGTCGTCCGGGATGTGGCACCTACTGGACTTGCAG
CAGATTACAATGCACACTGTCGTGCGGAAGGTGACTATTCTCGCATTATTGTGGACAAACTACGTGTCAGAACGGTAAACGGAGTCGACGTTGCAAACGT
AGCGTACGCGGATGTCCTTCAAATGTGAGCAAGAATCGCATTTTGTCAATGATCACATTATAACTTTTGATTCGTGTGTCTGTTCTTAGGATGCGCGACG
CGAAACCAGCATTGACTCTGACTCTGGCCGACATCAGTTCTGGGCAGGTGAACTTGGCGCTTGAAGAGCGGTCAAAAAGTCTAGGTTGCCTTGCTCCGAC
TCGACAGAACCGACGCAGAAGTAGTCTTTCGATGGGGCTGGGGAAGTCTAGCTCTCGTCGCAATAGTCAAACTGGCCTCGAAATCAAAAGCGACTGCCTC
CAGCTTCCTAAGTCTACGAACTCGGAAGCTGATGGCTTGGATGCCTTGGTAAATAATCTGAAAACCGAGTACTATGAAGTGAGTCAACAGTTGAACACGG
TGAGAGAGCAATTGAGTGCGATGCAGCAGGAGAGCGAAGAAGCAGTGAAAAGAGAACAGGAAGTCGCAGCTCGTCAACTGGAGACGTTGTTGCAAGAAAC
TCGCAAAGTGCAGCGAGAACGCGATGACATGGTAGCGGTTAATAAACTGCTTCTGAGACACAAACGGGCATCTATAACCACACAAGCCGATCTGGAAGCG
GTGAAAATTGAGCAGGTGCAACTACAACGCCACCAAGAGGATCTCGAGCAGACATTAAACGATCTCCAAGCTCAACTCGTAGAGCAGACTGCTGCAGCGG
AAGAAAGTCGAGAACAAGTGACTCACCTTCGACACGAGAAAGAAATGCTATCGCTTCAGTGGAATGAGTTGCAAGAAGAACATCGAGACACGCAGAAACA
AGTTGATGAATTACACGATCGACTGGTTGATGCTCAGCGAGCACATCGTGCAGTAGAAGTTGTTCTTGCGGCACTTCGGACCTCTCATGCAGCAAAGACT
CATCAGGTGAAAGAACTCCAGGCTGCGCTTGAGTTTGCCAACTCGCGTTCTTCAATCGCTTTACCAGCAGCAGAAAGCCATAATGTTGCTGAAGTTGCTG
CGGGTGCTCAACCATCCGAGCCAAATTCAACGATGATGTCTAAAGCTGATCCAAATGCAGTTGGAGCTACTCAGTCACTACAGAAAAAGCTGAGGGACGC
TAGTACGGATTTAAACCAGCATCGAGACGAATTGCTGGTGGAATTGTCATGCCACGACCAGCAATTGCAGCAGTTACAGGAACAAATACATGCTTTGGAG
CTAGTGAATACAACGAGCAAGCAGCTGCTGGCCTCGTTGCACGAAGAACTACGAGAAGCGCAGGCTCGTGAGCGCAGCATGCGTAATGAGTTTAGTGCTG
AGCTCGAGGTCGTCCGAAAGCAGGTAGTGCAGGAAACGCAAACCGCACTAAACGATATGAGCCGTCAAATAAAAGAGCTTGAGCAGCGCTGTGAGGATGA
ACGCGCGAGGAAAGATCAGCTTCAAATGGTGGTCGATGAACTGGAGAGCACCAGTCGAGCACGTGTAGCAGCTCAAACAAAGGAACAAGAATTTCTCGCG
CAATTCAAGAAGCAGCTTGAAAATGGCATTGTAGTGACCAAGTTCGGGTCGCGTGGTTTGCCTCACCAGCGCGTCGTGTATGCAGATCCCCAGTGTCACT
GGTTGTCGTGGCGTTCACCTGCGACGTCGATGACATCCGGCTCACTGATGCAGCCGAAACCTGACTCCAAAGTCGACACATGTGATCTAGTAGAAGTGCT
TCCAG