Description :
From Genome Similarity Track
Location :
contig_26:247617- 249135
Transcript NameFunction/comments
g5460.t1hypothetical protein

Sequence
1518 bases(100 bases per row)
TTGAGTATAGTTTCACGTGACTCAGCGGCGACGCAGCCCGCGAAGGTGGTACTGCCCACAGACTTGAATATGGTGTGGCTCGCCGGCTCGGACGTGGTGT
TGACCGCAGACGTGGCTACGGCGGCGATCCCGACACGGTCACCAGCCCGGCGGAGAGGCTGGGCATGGTAACGGAGCCGCGCACGGACTTGGTGGCAGCG
CGGTCTGAAGCCTTGGCCTTGACGTCCATGGCGGCACGGACACCAGACTCCGCTGCGAGGCAGCTGGTGACGGCGGTGTCACGGACAGACTTGGTGCGCA
TGACCTCGGTGTCGGTGCTGCTCGCGGGCTGGTCGGGCTGTTGCTCGCGGACTTGAAGGAGGACCCGGTGTCGGTGCCAATGGCGACACCACCGCCTGAT
CCGTTGGAAGGACTAGCCGAGGTTGTGGTGGAGGGCGTGCGGCCGAGACGGGGAGGTGGTGCGTGCGTCGGCGCTATTAGTCGCCGGGAAATGGGGAGAG
ATGGCGGCGGCCGCGCTCGCGCGACTAGAACTCCCCTGGAAGGCAGACCACTGAAAAAGCACCGCGGAAAGCTGCTTATGGTCTTCCCGTACGTCCTCTT
GAGACTGGCCAGCCGAAGACGGAGCTCGTTCGCAGAGCGCTTGGTTTTCATCCGACGGGCCACATATGCCCAGGTGATGCGAAGGCCTTCCCTCTCGAAC
TGATGTGTGATCTGGACCAGTAGCTTGTCTTCTTTGTCAGTGAAACTTGTGCGCATTTCTGCTAATTCTTGTATGTGAAATGAAGTCAGCATGTAGTGCA
TTTGACTTACCTTATGTATGGCGATGACTGGCTGCACGGTGATACTGGTGCTCATTGTTTTTGCAGCGCTTGGTCGATGACGCGGCGGTGCGGCTGCGGC
CGATTACGGCGGCTGAAGCAATAAAATACACCTCGGAGACACGAGCATTTGAAAAATACCCCCATCCTTCTTAAACAAAATGCTGTGATTGGTAGTAATA
TTACACGGTAGGTCGAGCACGGGATCAGGCTAAAAGGGCGCAAAAATCGCCCTTTTAGAAGTCCATTTGTCACCGTGTTTTGGAAACAGCGTTAAAGGGC
GAGAAATGCGCCCTTGCACCGCGAAAGGGTTAAATTATTGACTGGTTCAGAGACCAGGCGATTCGAGTCTTTTGTTGTTCACGAGGACGTTTTTTTCGGG
AGTTCTTTGCCCATGTGGCTTCTTTAATCCAATCAAAATGATTTATTTTTTATGCCGAGTTTATCAGTCGGATGCAGTACTTGTACTATACTATAGCGGA
TGGCGTTCAGCAGCGTCGGCTTTTTTAGTCGTTGTCTGTACCTGATCAATACCTAGACGGAGTTGGGTTACAGGCTGTGTGACGCAACTTCAATCTGCAT
GGGCTTGAACCTGTTGCAATGTTGTACCTAGCAGTTCATTACCTATTTGCCGACGTTAACGAGCCGCAAGAGTGCCTTGAGTGCTTAGGCAAGACGCCAT
TGTGATGGTTGTTCCAGG