Description :
From Genome Similarity Track
Location :
Scaffold_1537:2476- 4943
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1537-fgenesh-gene-0.0Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_1537-fgenesh-gene-0.2Nucleoredoxin

Sequence
2467 bases(100 bases per row)
TGCAGTCCGCGCACTTCACGATCCCGCTCAGGCCGCAGGACAAACCCGCGAGTTTCCCACCGAACTTCGCGCATGCCGTGAAGGAAGAGTACGCAATTAA
GTACCTGCAAAAGCTCGGCGCGCACCCGACGGTCGAGAACATCGCCATGGTGCTTGAGAACCTGCCGCTCGAGGACTGCCACATCGCGACCGCGTGGAAG
TCGAGGGGCTCGCTCTCGGACGTGATCACGATCGACCTGTACCCACACGCGCGCCCAGATATACGCAAGCAGGCAGGGCTGAGCTACAGTAACTCGTCGC
AGGGCACCGGCAAGAACAACGAGACCAAGAGGTTTGTGTGCATGTATGCATGCGTTGGCTGTGAGCAAGCGTATTAGTTTACTAACCCACATTAATTATA
CACATTGTTGGACTTGCTGCTCAGAATTGAGCGAGATTACTTGGCTAGCTTCGGCAATAATAACCAGCACGAGCGCGAGTCGAGCTTCTGCGCGTTGAAG
CCCTACCATGTTGGTCCCGTGTGTCTGTCATTCGACGATATGAAGCGACAGTTCCTGCTGCCGTTCAAGCACGGATCGAAAGAAGAGGTTGACGTGCTGT
CCACGTACGGCATGAAGCACGGCGAGTCCGTGGCGTTTGTCAACATCTCAGCGCTCTCAGAGGCAACCGATGGTTCTGTTCTGCACATCCTTGGACGAAG
AACGACGCAGCGAGGAGTCAAGTGCATGGAAGAGCGCGTCATCCCACCGGAGGTCAAGCACGACGTGATTCTGCAAATGCAAAAGTCATTCTACGGCTCG
TTGCCGCTCGCAGCTCTCGGTATTCGCAATGAGTGCGAGAAGCTGAGTCTGTACAAAGCATCGGTCGCTGATACAAAAGTGACCCAGCTCATTCAAAACC
TCGCGCGGTACTTGTACCTCCAGGTCTTCGTTAAACTTGCGTGCACTAGGGCAGCCGATCTGATCAAGCAGCACGCGAGCGAAGCTCGCTCGGTGTCCAC
GACGGCACTTGAAGAAATTGAAGCGCTGTACGTCGCAATCGTGCGCATTTTCACGACCGTCAAGCAAAAGCTGACGCGCGACGAGGAGAAAGGCATCAGC
TTGTTTCTCCCACTGCTCTTGCTGGAGCTGCGCGTCTGCGTCGAGACAGTGTACCGCGTCCAGTACCCCGTGAGCTTTAACGTGACTGGGCCGACGATGC
AGTACATCCTCATGCAAATGGACGGCACGATCACGAAGCTGCTGGACCCCGACGAGCACTTGAGCCGCATTGGCGTCCTCGAGATGACGTGCGAGTCGAC
CAAAGTGATGGCGTCTCACCCGTTCCAGGTAAAGAAGCGGCAACTTCGCCTCCGCGACCAGTTTTACAAGACGAGCGAGGCGCTGCACAGCATTTTCCCT
CGCCCTTTGCCTGGGAAATGCCGCAAGATCATCAAAATGCGCAGCGGCGCGAGCGTCGCCAACTACCCGCCGCACTTGGAGCCGCAGGAAGTGAGCAGTC
TAGACAACACCGACGATTTTAGACATGGGCAGAACGAATTAAATAACGGCGCGAGTTCGCTGCCCTCAACGCCGTCACAGCAAGCGAGACATCGAACCGA
GATGGACGTGGATCAAAAGAGCGTGTCTGTGGACACGAGACTCCAGCTGTTGCGCATCATGGAGCGCAGGGGCCGCAAGACCAATCGATGAGCTGTTCAG
GCAATGGCTACTTTTGCTGGAAATATGAACCTATTGTATTGATTTTGTCATCCTTGTTGCGGCTTACCGTTTCTTTATATCAAGAGCCTAACATTTCCAA
AAACTATTGTAGATACAGGGGGTGGATGGCGTGCATGAGGGCCACAAACCACGTTGTGAAGCGAACGAGCGAGCGACCGAGCGTCGTTCATATGATCGTT
GTTCCCGATCGCTCTGTTCGCCCATTCGTTTTTCGCCATGTTGCGCACAGCAGCGGCCTGTCTGCAAACGCGCGTCCGTGTGTTGAGCAAGCAGTCGTTT
ATAAAAGCGCAGCGTTGACGAGGATGCTCGGTGCATCGTCTCGTTTACTGCGTGAGCTTGGTCCAGAGCGCCTCGACGTCACCATTGGCCTCCGCAACGA
GCGAGCGGCCGTCCATGGAGATGACCTCGCCCTTGTCGTTCATGAAGATGAGCATCGGGATGCCCGTGACGTTGAACGCGCGAGAGAGCGCGGCCTGCTG
CGCGCGGTTCTCGAACGGGATCGCCAGGAACGGCATCTCGGTAAAGTACTCGTCGAAGCTGGCGGCGTCGCGGTCCGCCGACACGAACACGAGCTCGAAC
TCCGGATGCTCCTCGACCATGTCTTCGTACGTGGCGCTGAGGAACGGCGTGAAACCGCGGCACGGCGGGCACCAATGCGCGCTGAAGTAGAAGCCCACGA
CCTTCTTGCCGGCGAGCAGTTCCGACGTGGGCTTGTTGCCGTCCTTGGTGCGCACCTGCTCTCCGAG