Description :
From Genome Similarity Track
Location :
Scaffold_1474:2476- 4538
Sequence
2062 bases(100 bases per row)
CACGGGAAGCAACATCCCCTGAATGTTTCACATCCTGGGCTCAGCTGTGTGAACAGCTCCGAGCCGCGTTCCTCCCGGTGAGCTACGAGTACCGCCAGCG
TTCCCGCTTCCTCTCATGTAAACGAGGGAGGCGCGATCTGCACGAGGATGTGCAGGGGATACGGGAGCTCACGGAGTCCCTAGTGGGACATTCACTCAAC
GAACACATCAAGACGACTGTGTTCATGGACAGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGTTCCGGGTGCAGTCAAGCACCCTTGAAGAGGCGATTC
AAGTGGCTCTTCAACAAGGGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCATGGCCTGGGAGTTCTTTGTCGGCTCCCAGTCGAACAAGCCCCAA
CGGACCGGTTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTTCGGGAAGGTGGGCCACTTCAAGCGCGACTGTTCCGCGGAA
AGACTCCGCAGACGGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGGTCCCGGGGACAGGGGACCGCAGGGAACCAGTAGGGGCGG
GGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGTACCACGGCGACTTAGCCCCTGAGAGTCTTCGCACTCTCGAATCGGC
GAAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGGTACGATCACCCCTTTAGAATCTTGATTGACTCTGGGGCGTCGAAGAATTTCGCA
CGCCGCCAGACGGTTGCTCGTAACAGCAACAAGTTGTCCGAAGCTTTGCGAGAAAGCAAGGGCAACGGGATGGTGTCAGTGCGACTGGCCGACGGGAAGG
TCGTCACTGTCCCCAACGTCCAAGTGGATCTGGCTGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGATATGGATCCATATGATAT
GATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCAGTCCGACAGAGCATTG
GTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCGAGGGCTGCCAGGGTACCAAAGCATCCGGCAGATGCTTGGGAGTCGTCGACGTATATG
ACGACTCCGAGGATGTTTTGATGGTGGCCGCGCCCAGAAGAGGCGCCGGCCAAGTGGGTAACTTAGGTCCACAGGCGGGTAACTTAGTTCCGCAGACAGC
TGCAGCTGTCATGAACATGAGAACAGCGTGTTCAGAGTGGGTAACAGAGTTCCACTCACGGTCGCCCAGACCATAACTGAAGAGGAAGACGTCGGATACG
CTTCCTGTGTGAGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTAACACAGTGCCACA
CGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTACAACAGTACCACACGAGGCCACGAGTGCCTCGGATGTCGTA
GCGACGACATCCCTAGACGTGGGCAGCAAAGCTCCCCGTCACAGAAGCCGTCGGCAAAGACGCCGCCGCCGCCTCAAGTCGGATCCGAACTTCGTTCCGA
TCGACGTCGCTTCAAGCGACTCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGCTATCACATCTTCGATAGCGAGACGGGTTTACC
CGTCAAGGCATCTGGTGTCCACTTGGAACAGTTGCCAGAGGTTGCAGAGATACTGAACCTCGAGGAAATGACGGCTGAGTCTTTCCTGGCCAACCTCAAG
GCTGGAGAGATCGCTGAGATGGTACTCATGAGACCTGAGACCACTCAGGAGGAGCTGAACTCCTCCTCTGTCTTGGACGAGAACGTCCTGGAAGACATGA
ACAAGCAGCGTCAGGCGCGCTTGGGTTCTGAGATTCTCAAGAACCCCAAGGATCCGGTGTAT