Description :
From Genome Similarity Track
Location :
Scaffold_122:24752- 25777
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_122-snap-gene-0.20Rab11 family GTPase

Sequence
1025 bases(100 bases per row)
GCATTTTCGTTCCGCCCTGTTTCCCCGCCTCTCATTCACGCGTATTTCCTGATTTCTCATTCGTGTCCGCCCCCACCCTAAAAATTTGGACCGCAAGGTG
GTCCTAAACGAATGAAACCCTCCCTACATAACGACTATTCCCATGTAACTCTGATGTAGATCATTTAGAAAGTTCTTTCAAAGTATGAATATCTACCAAA
CAAAGCTCTCCATTTGTATTTTAAAAAATCTTATTCGATAAGAAGGCTATTAAAAGCCAACGTGGGTTTATGGGTGCGAACGAACGAGGGCGGAAAATGG
ATCGGGCAATCGAAAAAAGAAAGAAGCCGGCCGCCTGCCGCCTGCCGCCTGCCGCCTGACGCTATCATCGCCAAAAGGCCAGAGCGCCAAAGTGAAGCGA
AGTGAAGACGGGGCTTCCATCATCACCCCCTGCGTCCACACGCGTGTTCACGAATCCAGCAGGTCCTCCCCCCATACACACAGGCAGCCTCTCTCTCTCT
CACACTCTCACGCCCAAGCAGCTGCAAACTGGCGCGCCAATCACTCTTTTGCTTCCCGCGTTCGCGTTCGCGACTATAGAGCTCAAGCAAAAAGCAGCAG
CCAAGCAGCTCAAGGGTATCTATCGGGAGCATTCGTTCACTTTCGAGCCACACACGCACACGAAGCGCGCATTCGTCGTTCTCTCTACGGTATCGAGAGT
GTGTGAGAGTGTGTAATTGGCCGCCATTCGCAAGTGAAGCGCTTCGTATCCGTCCCTTCGCGCAGCTCGTTCTCCAGCTCGTGCTCTCTCGCGCACGCTT
TCAGGTCTTTTGTTCCGGCGATTTGTCTGTTGATCAGTCAGTGGGGGATTTCCTTCCAATCGAAGAAGCAGAAGAAGATCACGAACCAACAGACAATCGC
ACAGATCACTCGCTGTTATTCGTACATAGATTCATCATGACAGGCGGCAAGCAGCAGTCCCAGCAGCAATCACATCTGCAGCAGGTGCAGTTCGACCCGC
TGCGGCAGTACATCACGGCCAAGGA