Description :
From Genome Similarity Track
Location :
scaffold_638:2475- 3814
Transcript NameFunction/comments
Pl_103287flavodoxin/amb allergen/pectate lyase

Sequence
1339 bases(100 bases per row)
CGATCACGCGTCCTTGACATGTGTGAGTATGGAGCAGTTTGAGGCCAAGCAGCGAGATAAAGTTGTTAGTGTAGCTCCTGAATGTTCGAAGATGGGCAGT
TCGAGGCCAAGCAGCGAGATAAAGTTGCTAGTGTAGCTCCTGAATGTTCGAAGATGGATTTGGGGGCGAGACTACGACTGTAGCCAGCGTTTCAACAACG
TTGGCATGCGTGAAGCATTTCTCTGTACGAACGACTAACTTGTTGAACCTGCTGGCCGTAAGGAAAAAGAGGATGTAGAGGTCGGTCCGACGCAAGGTGG
TCCCCGTCACGTTGTCATCAGTATCGTAGGAAGACAACTTTTCACGGAAAACACGACTGAATCTTCACCACTCGAAATGGCCCTCTCGTTGATCTTTCCG
TTGTCGCTCTAGCATTTGTCTCTGTTGTTGATTTAACGCTGAACCAAGGGGTAAGTCGATGACCAATCCATGCTCAACCTCGACTGTCTCGACAAAAAAC
TACAAGGTCAGCTACAACACATCAAGAAAGACACAACAGAGAACGACCCAGCGACTACACTCGCACGGAATCTGAATAAGTTCTTTGCAGTGCAGTGGGG
AAAACCAGCTGGAACAGCGCTCCGAGCGGCAAAATTCATGGCACAAACTAACACCACGTTCATCTACAACCCGCAAAGCGCCGGAGGAGCTTCAATCCCC
AACACCAAGACCAGAAACACAATAGCAGAATCAACACCCCAGCAAAAAGAACAAATCCACCCAAAGACGGTCGACATAAGGACACGTCTCACTACATATA
AGGCTTCTATAGGTCAGTAAACTTGCTCAAATAGAAGGCCACTTACCACTGTCTCTCGCAATGCATTCGAATCGAGAGTCAAGACTTTATCTGTTCTGTA
GAACTACCAGACTCCATCTTACATTTTGAACGTCACTCTTATTGGTTTAGTTCTCGCCATGAAGAGTTGTCAACGAAAACAAACATCCATCGACTAACTG
TTTCTTCACTCACTTGCATCAGTTTAGTTGAGCACACCAATACCAAAGTTGTTGGTGGTCTTGCTCCACTCCACAGCCGAGCGTGGGCTGTATCCAGAAA
TGGCCGAGTACGATTTTACCTTCGACAAAGCCGTCGCTCCGTTGCGTGATCCGAACGATCCGCTGTTGGACACGACATTAGCGGCACACGAACGACCCAA
GTAGCTGTTGCACTCTGTTGTCGCAGTAGCGGCGTACATGTTGCCGTCAGTACCCGTCAGCAGTGGCATCGTGGTGTCCTTGAAATAGTTGCCCTCAGCC
AAGATCCACGAGTTGACACCCACCTCGAACGAGTGACCT