Description :
From Genome Similarity Track
Location :
Scaffold_171:24744- 27334
Transcript NameFunction/comments
Physo_144176Arabinan endo-1,5-alpha-L-arabinosidase A precursor (Endo-1,5-alpha-L-arabinanase A) (ABN A)
Physo_124664pectin lyase B

Sequence
2590 bases(100 bases per row)
GGGCCAACCGGTCGAGAAGTCCAGGGTGTTCCAGCCGAATCGTTTGTCCCCATCTGCGTACCCGATGCGTGTGTCAACTATGGAGAACAGATCAACAACA
TGGTTAAACAAGGAGTATGAGCTGTTCGTGTGAGTGTAGTGCACCTACCGTAGTGGTAATACAGCACGGGCCCATAGGTCGGGTCGTCGTAGACGCCCTG
TCCGCCGGGGGCGTAGAAGTATCCCTCCGACGCTCGCACCACAGTCCCACCGCCAGCCCTGCAATCCTTGCCGCTCTGGTCCACGAAGCCGCCGGTGGGG
GACGAAGACCGACATACGAGGATGCGGTACTCCTTGCCCGCAGCCGGGCGAGACTTGTCGAGGTTGCAGCATTGTCCCTTGGACATGAAAAGGTAGTAGT
AGCTGCCGTAGTGGAACACGAACGCAGCTTCCAGGACCTGATAGTCACCCGTGAATGCAATCTGGTAGGGGGTACTGCTCGGCATTACTGGAGGGTCTCG
CATGGGGGCTTGGTAGAGTCCCTGCCAGTAGCTCCCAAAGCTCAGGTAGTACGCGCCGTTGACTTCGATGAGGTTCGGGTCGATGGCGTTGTAGGTTTGC
TGGAGCTGCTGACGATGCCAGTGGTCCCGCGATCCACCCAAGTGCCGACGTCCATTGTGCGGGAGCGCGCGAGCCCAATGGCAGAGTTCTGCGTGCCAAA
CGTGCTTACAGAGTAGTAAAGGTAGTACCAGCTGCCGACTTTGCGGACGTCGGGGGCCTGCCAATTTACAGTAAACATATCTCTTCATGCAGCACTAATA
CATTTCATACGTACCCAGAGGTCATCTTTCCCGTTGAGATTGATGATCGAGCCGGCAGGAACAGCGGCCCCCTTGTACGTCCAGGGCCCCGTTAGAGCAG
GCGCAGTGTGGATGGCGATCCTGCCGCCGGTGGAGAAGCGGAAGTACGTTCCATCGTCGCGGCGGATGATGGACGGGTCGTGGGCGTTCGTGCAGGCGTC
AGTGCACAGCTTCGGTTGAGCGTAGGCGTCGACGACAGTGGTGGTGGTCACGACCAAAGACAGCAGGGCGAGAAGCGAGAGTCTTTCCGCCATGTTGGAC
TTGTGCCGGCGAGGAGAAAACGGAAATGAGGCTCTATGCTATCAGCACAGAACCTCATTTCGGCCGACTCGGCGGTATCCGCGTCAAGGGCGTGGGCTGA
TCCAACGCATTGAGACAGTTGAATCTTGAACTACGCACGCGAAATGCAACTTGTATTAGTCTGCTCTATGACAAGACATCCAAAGTTTCATCAGGGCTAA
ACAAACAGTACATGTACAGAACTCTGCCTGAATACCGAACGCCTGATATATATAAGGGCTCCAGGTTGATAAAGTGATCTCAGCGTTACCAGAGAAAGGC
TGTACTGAATTAGTTTATCTTAGACGGGATTTGACGCTTGCTTAGTTAATCAAACCCGAGTAAAACAGTGCTGAGTTGTTTCAGCGCTGACCTTCGACCA
AGCGTGTTCGCACCACATCAGTGCGGTTAGTAGCTCTACTTTGTACTACTCCTAGAGGGCTTAGCGGGTAGTGCGCAAATGTGAAAGTGGAATCGTAAAT
ACAGAGAAGATCGCACAGACAATCAAAAGGGCGCCAATTTTCAAACTGCACAGCTTAGTACTTTTAGCCAAACAAAGGTATCCTGGATTTTTACATCAGT
ACCTTTGCCCATCTCCGTTCGTCCTGTTGTTGGACCTTGAAGTATTATTTATATGAGGTTATGTATTGTATACCCGTTCGGTATTGAGGCAGATTTCTGT
ACTCGGTGCAGGTACAGGTGCACTACATTTCAAGGACGCACATGAATGTGTACAAGTTGCAGTTGTACCACTACAGTGACTGCTTTAACACTAAACGTCT
TCAATCTAGTTGAGCACACCAATTCCAAAGTTTTTGGTCGTCTTGACCAGCTTCTTCGCCGCTCGTGGCGCGAACTTCGAGACGGCCGAGTTGCCCTTAA
TCTTGGACAGAGCTGTGGCGCCGTTGCACGACGTGAGCGAGCCGCTCTTGTCCAGCACATTCGCCACACACGACCGACCTAAGTAGTTCTTGCATTCGGT
GGAGGCCGTGGCTGCGTAGATGGCTCCCTCGTTGCCAGCCGACAGCGGCGCCACCGTATCCTGGTAGTAGTTTCCTTCGGCAAGGACGTATCCGTTCTCG
CCGAGCTCGAACGAGTGCCCGGAGTTGTCCGCCCAGTAGTTGTTGACCACGTGTGCAATAGCGTTGGCGTCGCTGGCACCGCCGATCTTGGGGGAGCGGC
CCGAGGTCGAGTGCACGTAGTTGTTGACCATGCTTACCTTCGTGTTCTTGCCGTACAGGAGGAACGTCCAGTAGTGGCGGCCGTCGCACGAGGCGGAGTA
GTCTGTGCGGCCGTCGAAGTCCGAGTTGCTGATGGTCAAGGAAGCGACCTCGGCGTTGTTGGCGACGAGGAACTGGCGGCCGATGCGAGAGATCTTGATG
TGGTCCAGCCAGATCTTGTTCATGGCCGTCGAGCCGCCGTTGCGGCCTTGCATGTAGATGGCGTCGCCGCCCCACACCAAGTGACGTCTG