Description :
From Genome Similarity Track
Location :
Scaffold_50:247416- 249637
Sequence
2221 bases(100 bases per row)
CCAGGGTCGGAAGGATACGAGAAATATGTGTATCCCTTTTCAAAAACTAAGTGGCGGACGTATCACTTGCACATTTGCAATACATCCGACAGGATGGGAC
TGGACGAGCTTAAGCCTGGAAACACAAAACGAGCTAAGGCAACCGCCATCGCAGCGTTCAAGGCTTTTGTAAAGAGTGAGTTTGTAGACTTTGAGTATGT
CAGGCGTTGCATTGCGAAAGATGATAGTGTAAAGTCATTTGTGTCTATATTGGATATGTTTGGCATGTATCTTGCCTTTAACGAAGGCAAGAAGGGTATA
CAGCTTGTCCGCAACACTGCCATATAGTACTATAGACGGACTAAGATGTGGCTTTTCGAGCTCTTCCCCACGACTACGCTGCACTTGGCGCTATGGCTGC
TGCGGCGGACGGAGCAGTCGTGACTGGGAACCATTTACTCCCACGTCAACAAAGTTCTTGGCCGAATCGCTGTCGCCGCTGGTATCGAGGTCGCCCTCTC
TTCTCATTCCTTTCGCCGAGGCGGAGCGCAGCACGTCAACGGTTGTGACGGCCTCACGCATCGCTGGATTTTCGACCGTGGTGCCTGGAACCAAACCAGG
GGTTTAACTACATCTTCAACACAAGCCGCGAGGATCAAAGGTAAGCAAGGCCCTCAGCGATTACAGCACAGAAGCAAAGGTACATTTGAAGGACTGGAAG
GCTTTTGATGCACACACACTGTAAAAAATTCGCAGTTGTCCAGCAGTATCTCTTCGCGATGTGCCTGAAGTTAGAGCAAGCCCAATACAACGTGAGCCAC
CGTGCTCTGGACGTTCTAACAGCTTACCCGTTGCTGCACTATCCCCGGTTAAAGCATCTTCATCCTGATGGACCAGCTGTAAAACGCATCGAAGAGTGCG
TGGTTCTGGCAGGGTCATCACGCGCAGACTTATTGGTTTGGGCGTCCGGCCTGGCTGCTCAGAATATTCCTACAAAGACACGTCTGCCAGAAGACAAGGA
AGACACAGATCCCACATCGAACCGGCAGCCAAGGCAAGAATGTGATATCATTGAGCACCAACGCCGTGTCATTGACCAGTTAGTTCTGCTCGTTAAGAGG
CAGGATGAACGCATGGATCTTCTAAAAGCGAAGGTAGGAGGTGCTGTGCAGCAACATACAAGCAGCAAACGTCAGCATGATCCTGAACCCGACCCAGTAA
AGCCAACCAAGCGTCGATGGCCTTCTGTGACCTACCTGCACGCGACACGGTACGCTTGGTACGCTCAGGAGCCCCGTTTTCTTGCCGCTGCATCCAAACA
GCAACGATCAAGCGCGAAGCAGCTCGTCGGATACCTGAAATTGTTTCTTGGGGGCGACTTCTCCCTCAATCCAAGCGCATGCGACTATCGTGAGCAGGTT
TTAGCGAGAGGAAAGCAGGCTGAGACGGCGGTAATTACCTTCCCTCGTGAGCGCAATATCATGTCACGTGGGCCCACTGCTGTTCGAAAGCACCATCATG
GCCTCCACGCTGCTGGAGAACTAAACGACATGATCACGCGCTACCAACGTCTGGTTAATGCTGGTGCTGAACAAGATCCAGATAGCCATGACCCCCTTCA
ACCAGTAGCTGCAACATCGTGAGACACAAGCATTAGTTACCGTTACAATATCGGGAATTTCGTACACGTTCGTACTGCGAAATTGCGCACCCTGTTTCAG
CACCACAACCACCATGATAAAACCGTAGTGGCCGTACTGGTATGCTAGCTCAGTGGTGTCGTGTAGCCCATACAACCCATACAAAGGGTGTCGTGTAACC
CGTACAACCCTGTCATGTAACCCGTACACGTGTCGCTTGACCCATTCAAGCTGCCTTTTACACAGCTCAAAATGGGCAGATGAACTACTGTATGCACGTC
CGCTTTCCGACTTGCAGAAAGTGGAGGCCCTAGCGCTCATGGACGTACAAGGCTGGAGTACTTCGGAAGCGTCACGTCAGCGAATATAACCCGAGAAAAT
TTGCTCGGGTGGGTCGCAAAACAAGACCAGCTTCACGCTCGAATTGACAGCGGCATTGCGGTCAGTCCCGGTCCCACACCCAAGACTTGTGACTTTGATT
AGGAAATTGTCAGCATGATCAAGTTGTTCAGTGATTGTGACCTTAAATTGATTCGTAGTGCTATTCTTGAAGACTGTGACCAGAGAATTCCTGAGTACAA
GATATTGTCGTATGGGGCTCA