Description :
From Genome Similarity Track
Location :
Scaffold_53:247411- 254694
Transcript NameFunction/comments
Hyaar_Emoy2806662hypothetical protein
Hyaar_Emoy2806663PREDICTED: dihydropteridine reductase-like

Sequence
7283 bases(100 bases per row)
GTCGTGTCCGAAGCGCTGCGCCAATTGTACAACCCACTGAGCTCCCCACGCAGTAGGAGATGTGCGGATACGCTACTGCAGCAGGTCCAGCGCTCGCCCA
GTGCGGCGCAGGCCGCATTGGCCGTGCTGCAAGCGCCAATCGTTGACACGGAAAATGTCGAGCACAATGCGTTTGTGCGTATCAGACGCGCGTTCTCAGC
GTCCACGATCTACGGGACAGTGGCCTCTTTTAATATGGACAATTCAGGAGACTGGACGTCGGTGGACCAAGATACACCTCAGCACGAGAGATACGTAAAG
GACTTCAAAGTGATGGCGCTCGATGTCTGGAATGTGTTGACTGGGCTCGATGGGACGAAGGAGGAGCCGCATGTGCAGACGCATCTGGCACTTGCAGTTG
CCGTCCTCTTGTTGCGGATCCTTGAACCTCAAGGGGAAAATATAGTGGCTCGTGCAGTGGAATCGCTGGTTGAAAACCAACTGTATCCAGTCTGTGATGG
GGTCACGACTGCGCTGACAAACTTTGCGGTGTTGCTGACACTTAAAGTTCTTCCGGAAGAAGTGAATAATAAACGCGTCCAATTTACCTCGGCTAAGCGT
GGACAGTGCAACGACATGGTGACGGAGTGCGCACCGCACGTGGTTCAAACGATTCTTCCGTCAATTGCGGCTGCTATTGATGCAAGTGGAGAGCAAGAAC
AATTGCGCGGTCTGTTGCTACAAACTGTAGCAAGCTGGATGGAACATGGCACTGTGGTCCCAGCAGTCCTCATTGAAACTGGCTTGCTCGACCGGTCGTT
TCGTGAAACACTCGTGCCAGCTACTTCGGTATACGCCTTCCAGGTCGTACGGGAAGTCGTGTACGCGTGCCGTCACGGAGAACACGTACAGCTAATGGAG
ATTGTGATGCAGAAATTTGTAGAGCTTGGAAAGCATATCCAAGAGCGTATCACGGGATCTGAAAATAGCGTGGCATTTTGCCTTGTCGACAGCGCGAGAG
CAATGTCAGAATGCGGACAAGCCTTCATCATGTATTTCGTGGACTACACCCAAGATGTACAACCTGGGTCCTTGGTGCATGAATTCCTCGACACGATTCT
GTTTTTCACGTCTTCAAATAACGTGTACGTCTCTAATGAGACGACGGATTTCTGGATCCATTTTCGCACGTATGTATCAGGCAAGCACGAACAGCACATG
CGCATATTTGAGCCGTTCATCTCACGCTTGTTGGCCATTCTAATTGAGCGGACCCAGTATCCCGAAGGGTTTAAGCATTTCTCGGAAGCTGACAAAGAGC
GCTATCACTTGTACCGAAGCGAAGTACGCAACGTTTTTCGCGCACTCGCCACGGTCACAGTTGCCAGCGAAGACGAGTTCATTGTTGATGCTATTCACGC
GATCTTCCGACAGTACGAAGCTGCTGACTCAAGCAACCCCTTATCATCAAATGTACGTGTAATCTGCGCGACTGGTAGAATGGATGTCTGTGGTATTGAC
AACGCACTTTATTACTGGTTATCTTGGGTGACATGTAGTGGTGGCAGCGCACCGAAGTATACGTGCACGCTCTTAGCGCACTCTCGAAGTCGATTCGCGA
GGAAGACACTTTGCTCGTTCCAAGGCTGTTTGAATGCTTGTCGCGAAAGGAGCCGTCTCACCACGCACTCACACGCACCATCACCATATTTCTTGGTGTG
ACGAGCCACTGGTTTGCTCGACACCCTGAGTACCTGTCGACATACGCGTTCCAGATCATTTCCAATAGCTTTGAGCTCTCTGACAATGATGTTGATTTTC
CGACTAATCAGCATGACACAGAAGATCACGTTGGGGCTGTGGCACTGTGTAAACTGACGCTTCGGTGTGGCTCACACTTTTTCAATCCGCTGTGGATAGA
TGCACTGGTGAACCTCTACCGCTCGAACTTGGCGGCATTAGGCGGGTCGACGTGTAAAGGGTTGATGGGCAATAGTGCAAGACTTGTCGTGGACTCAATC
TGCAATATCCTCGCTACAGTATCATATGAGAATGCCCTCCCTGTGGTGGACGAACTCGGTGCTATCATGTTTGCGGACCTCGCAGCGCGTTACAGTCAGC
TAACTGTGGCCGATGTAGGCCCAGTAGATTTCTTGTGTGAGATATTTGACCACCTGCTTGTGCTAGCTACCAAGGTCCCGATCCAGGTAGATCAAGAGAT
TTCGCATCCGGTTCGCTGTCTGCTGCAAAAACATTGGGGAGTTCTGGAGACCATCGTGTGCGTACACGGCTCCTGTGAAAAAGTGACTGAGCGATTCTGT
GCACTTCTCGTCGGTGTCTTCGAGTCTTTGCGATCCCAAGCGTTGGAGCTAGCATCTGCAATTATGCCAGCGTTGGTGGAACAATTATTACGGAGTCATG
ATGGCAGTTATCTTGGTGTGATTCGAAGCATCTTTGGTTGCGCTGGGAACGACGAGGCTACAGCGGTTAGCCTGACACGTGTGATGATCATAGCGAGTGA
GAGCTCCATGAACAAGATTACGGCAGACGGCAGTGTCGATGAAAACCCTGGACTCACTATAGCGCTGTTGTCGTTAGTGGCGACTTGCGCCATATACCAC
CCGTCGATCCTGGTCCAGTCGAATCAGCTGGAGGGTGCGCTGGCACTGGCTGTACATGCACTCAAGTCACTCAACCCTGAAGTCGGGGCTGCGGCTCTCA
ATTTTCTGCTCGAGTTGGGCTCGTTGTACGGCCAGATCCGTCGTACTCCAGACCACCTGCTTCAGGGTTCTGAGTTTGCAGGCAAGATGCTCCTTCACCG
ACACATCCAGACGCTGTTGTTTGAAAAAGACGTTCTGTACCACGTGCTCATTGCTCTGTTCGTTGCCGGGGCTCGGGATACGCCGCCCAACTCGGTTGGG
AAAATAGCGGAGGTCGTTCAGTCTTGCTGGGTCCATTTCGGACGACTACGAGCTGAAGCGCTTATCCATCGCCTTCTATTCGACATGAACTTTGCAGGAT
CGCGAGTTAGTGAGCGCGCTCGAACCGATTTCCTCGACCTCGTATCCACTCCTGCATGCATCGAAAACTCGCGTAAATTCAAGCGCGTACTGAAAACATT
TTGCGACCACCTCAAGCGCAAGCTTATTGCTCATAGTGCGAACGGGAATGTGATCGCCTCGTAAGAAGACACTGCACTGTACTGCTCAGCTGTTAATACT
GCACCGAGTCAGCAGAAATATGTGATTATCACTCCCTTAGGCCTCGATGCAGCACGACGTCACATCGTCTCAAGAACTTGTTCTGGCAGCCTATGTTTCT
ACAAAAACGGGTTGCCTACGTCCGTCCAATCCGTCGTATTGTTCTCCGTGACACAAGTGACCAAGTGTCCGCTCGGAGGACGGGCAGCATGGGAAGCAAT
CGACCATTCGTATATCTTTTGCGCGATATCCTCCACCTGGTGTTTCCATCCCCATGTGCACGTAAGGGCCACGGTCATGTGAGCGATCAGACATTCTATA
TTGTTTCATCCTAAGCCCGTACCTTCGTCCAGCTGGAATAGTCAGCGTCGGCCATGAACTGACGGTTCATCGGCGTATCGATCGTCGTCGGCAGGACGCC
CAGCACTGATGCACTCTCAGGCAGCTCCGTCCTGTCACAAGCATCACACGTTATACAACAACAGCACGATCAGTACACAAGTGTGAACGAACGTGTGTAC
TCATTGAACCTGAAACGTCCAACAGACTCACACGGCACTAGCAACCAAATGGTGCGTTGCCACTTTGCTCGCTCCATAAGACACCATGCCAGGTGTCGCC
TTGAGTGCTGCAGTGGCCCCAGTCAGAACGAGTAAGCCTCCAGGCACGAGCAAGTGACTTGCCAAGTACGTCGCTATGAAAGAAGGAGAATAAAGGAACG
ACAGAACCGATCGTCATTGAGCCGTTACAACCAGAACCGAGATAAGCATTGAGATCTCTCTCGGCAAGCACATTGTGTCTCACCTAAGAAAGCCGACTCG
AGATTCTTGGCGGTCATGTCCGATAGATTGGCCAGCGAACTTGCATCACGGATGCTGCCTCCTGCCCATCCTCCTGCCGTACACACGACAGAGTTCACGT
TGCCATATCTGTGTACCACACCGAGTCAGCATAATCTCAAGCAATATATATTGTTCCTTTATAACTAGCTGACCATAACAATACAATAACACAATACAAT
TACACAATACAATGACACAATACAATGCAATGCAATACAATACAATACCTGCTGGAGATCTCCTGCAGCGTCTGCTTTGCTTCCTTGAGCACGTTACTCT
TTGGCAGAAGCACGTTATGTTCCGCCTCTTCGTTCGCATCAAAGCCTACTGAAGTGACACCCCACGATACACGTGCAAAGCGGTGAACGATGCCACGACC
AAGGGCGCCAGCACCTCCAATAACGAGTACCTTGCTGGACATGATGCAGCAAATCGGACAGTCACTATCGAGAGACCTTTCCCCTCGATAGTGACATCCA
ATTGGTTCGTGACATAACTACATACAACAAGAGCAAATGATGACAATCGATTGGGTATTTTGAACTTTACTGTAATATTCCGTAGACGAACTGACTGATA
CCTTATAGTCGACATCTAATGGGCGAATCTCTCTTCTTTCTTCCCTGTCTATCTGTTTGTGCTGTGTATGATCAGTCTAGGCGAACTTCTCTGAATGGAA
GTCAAAAACCGTGCCGTTCACACCCGAAGACGAAAACCGTTTGCAAGTATTGTCCAAGATCTCCTCGAGCATGTGCGGACCGCAGTAAAACACACCAACT
TCCTCGCCTGGATGATTAGCTCGAGCCTGGGCAAACACCTTGTCCCAGTCGGGACGGCCAAAGTGCGTGAGCTGCTTCGTGTTCAGGCCTGACACGAAGT
CCTTGCCAGTCTGTTTATGCACAAACTCCTGGAACATCTTCAGCTGCGACGTATTCTCACTGCCCTTCAACGTGCTTAAATACTGGTGGGTCTCAATCAC
GTTGTCCTTGTCCATCTCCGAGATCTGGTTCATCGTCTCTTCAAACCAGCTCAGAGATTCCTGGCCACGAGTTACCCAGTGGAAATACAGCTTCTGGATC
TTGAACGAGCCCGGGTGCCGGACGTGACTGCAGTTCCGACAACGATTGTCTTCCCACAAGTGCACTACGTCTTTCAAGATTGAAGCGAACGGGGTGACAC
CAATACCACCACCAACACAAATGACGGTCTTGTAGCGGTGATAATCCTGAGTCGGAGCACCCACCGGCCCATCCAGATAAATGTCCGGGTACACCGCCTT
TCGTTCGTGGCAGCCCGAGATGACGCGTGACAAAGCTTGAGTCCAGTCACCACAAGTACGGATGTGGACGCTGATGTAGTTGTCTCCAGGGGCCGATGAA
ATAGTGAACGGGTGCCACTCATGCGGAGAGATCAGTGGGCAATTGACAAACATGTACATGCCAGGACGATACTCGAAACGGCGAGGCTTCTCCATGAACA
AAGCAACAGTGCCATCCAACTCCATAGCTTCCATGATACGCACAGGTGCAGCAAACAATTTGGCGTAGCGGTAACGACGTTCGACCAGGTAGATCAGAAA
GGGAGGAGTGATCCACATGTACGAAGAGCTGCGAGCGAGCCATGACGCAGCGCCATGGACCGCCAGCACGACCAAGAAGGGTCCAAAGAGCATGTGCGAA
TACCAGAAGAGATTGAAGTTGCCTTGACGGAACTTGGGAATCGCGGCCAGTGGGAACGAGATACAAGTGATCAGGAGCAGGATCACGCCCGTCCATATTG
GGAGCGCCTGAATCATCATAGTGAACGGAGGGAGCTTGCCGTCAATGAATACGTGACGCGTAGCGAAGATCGAGTGTGCGACTTCTTCCGGTTTCGCGAC
TACAAACAGGTTGACCTCATTAAAGACGTGGGCGACCGTGTGAATGAGGCCGGCAATCAGCAGCACAGAACCCGCAATTTTGTGAAATGCGATACTGTCG
TCGAAGGGGATGTAGCGCCACAAGAACCGACTTCGCTTCATGACTTGTGTGATGGAACGGCACATGGGGAGCAGTACGAACACACAGTTCAGCATGGCAA
CTTGGGCGTTGGCACGTGCAATGCGCAAGCCCCACCCGATGGCAGGATCCACTTCACACGAGAACCACTTGGTCCAGAACGCGAGGTTGTTCAGGAGAAT
GTACACAAAGAGCCACCATACCCGGAGTTTGTTGGCGCAATACCAAGCGCCCAACTTGCTTTTCGGGGCTAGAGGAGCCGTGTACTTGGTTTCCGACTTG
CGGAGGTTGTACGAATCGTTAATGTAAGGCGCAAACACGCTGCAGAACTGCTCGAACGTCATCACCTCGTCTTTAACTCGAGCTTTGCCGAACATGAGCT
TCGCCACCGACTTGAAGTCTGTGCCAACCACGTTCAAACGGGCTTCCGAGAAATTCGACTCCATTAGCTGGACAATCTGGTCCTCGACCACATACCCGAT
ATTTTCTGGATCAAGCGTTTCAAACATAAATCGCAGCTTCTCTTCAGCGCCAACTTCGAGTTCCATGACAGCGTCAATGAGGATGGCATTGCCATTGATC
GTGCCGTCATTTGTAGCGTAGCCATCATACTCACTCCCATCGACTTCGAATGCCTGGGAGAAAGTCTTGCGTTCAATACAGCCGTTTTTCGACGTAAGGC
TGCTCATCACATCGCGTAGTGCGTACAACTTCTCCATGGGCGTGTACATGGGATCATTCTTGTCATTGACACCGCAGTTGTTCATACTGATAGCCACATT
GTACTTCTGCTCAAACGTGCAGTTGCCAAGTACCGGCACCGACCCGATATCACTCCCTGGCTGCGGTCCGTACCCAGGGCCACCCATTGACGATAGCATC
GACGACATGCTGGATCCTCGAGCGAGACTCTGGCGCACCGTCGACGATCGGAGCATGGCCTGGACATCTACGCGACGCCGTCGGTTGCCCCTACTGTTCC
TGCAATTGGCACTCAGTCGAGCTGGGCCACGTCCAATGAGGTGAGCAGTAGTCGAGTCCATGGTCATGAATTGATTGCTGTCAGTGAAGTTGGACGTCCT
GGATGAGGGTGGGGGAGGGGGCGACACCGACGGCGCTGCCATTGCGTAGGCAAGTGTCGAGCCATTGGTTGAATCTGGGGTGATTGTACACACTGTCAAC
GGCTTGTGGTGACCGGAAGGGAGCGACGGCGTCGAGATATCGACAAATGGCTGCGCGTTGTGGCCAGGCGTGAGCTTGAGGTC