Description :
From Genome Similarity Track
Location :
Scaffold_1001:2474- 6162
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1001-fgenesh-gene-0.0Flagellar associated protein

Sequence
3688 bases(100 bases per row)
AGAAGAAGCCAAGGCCCAGAAACGCATCGACGAAGCTAACCGCCGCGCCAAGGAGATCGAGGCAGTCAAGCGTCGCAACGCCGAGCACGCGCGCGCCAAG
CAGCGCGCCTACGAGGAATGGCAGGCCGAGATCCAGCGCACCCACGATTTTAACCGTGCGTACACCGACGGTTTATTATAAGTGGGTTTGAACTCACTTT
TGTTTTCTACAATGATGCGTCTAGAACTAGCGGTCGCGACCTCCCGGGAACGCAAGCACCAGCACATGAGTGCGATCAGTGAGATGCGGTCGCAGATCGT
GCAAGAGACCCGCGCTGAGCGGGCTTCCCACTTGCAGCGCATCCACGAGAGGCGTCACGCGGACCACCGCGAACTGTCGGAGAAGTCGAGAGAGATTCGC
GCACACGAAAAGCTTGCGCTCCACAAGCGTGATGCCACGCGCCGCCAGAATGAAAAGGATCTGTTGCGCGCGGCGCGCGAGCAGCTCGCGGCAGAGCACG
CCCGGCGGCTGCGCAATGAGAAGCTCATTCAGCAAATGGAGAAAGAAGAGACGGCGCTGATTGAGACACTGCGCGTGACCCATGAGATGCAGCGTGCCGC
GTACGAGCACCTCGAGTTTGTGATCCATGAAAACGACGACTGAGGACGAGGACGAGATATATTTATCACCCATATCGATTTATAAAATCATAAAGAGAGA
ACCGCTGCGTGGGTTAGATTTCCATTGCTGCTCCAGCATGAACAAGCCTGTCGACGATCGCGACGTGGTCGTGCGTGGTCACATGGCTCAGGGCACTGTG
CCCTGCGTGGCTGACTTGATTCACGTCGACGGCATGCTCGATCAGCATGTCGACAATACGCAGATCACTGCGCTTTGTGGCGAATAGAAGAGCCGAGTCG
CCATTGATATCGGTGAGATGAGGGTCGGCTCCTGCCACGAGGAGTGACTCAACCAGTTCTGCATGACCGAGCTTGCACGCTGTCATCAGCGCTGTGGTGC
CGCCGAAGTTTGGAAGGTTAAGCTCCGCTCCGTGGGCGAGCAAGAGATCGACCGTCGGCTTGTGCCCGCTTCGCGCTGCGAAGATATGGAGCACTGACTC
TCCGTCTTCGCTTGTGTGGTGGATGTTGGCCTTTCCAGTTGTTAGCAGCGCCTCGAGAATACCAGTGTTCGCCTCCACAGCCGCGTACACCAGCGGCGTC
CAGCCTGCGCTGTCTTCTTGATCCACCGTAGCACCGAGAGCAAGCAGTGTCTCGACCACGTCCAGCTTACCCTGGCTCACGGCCTGGATTAACGCCGTCC
GCCAATAGTAATTTTCGCTGTGAATATTCGCGCCGGCCGCGACCAACATCTCGACAATCTCGCAATGGCCGGACNNNNNNNNNNACTGTGAATATCCACG
CCGGCCGCGACCAACATCCTGACAATCTCGCAATGGCCGGACCAGGCCGCCTTCAGCAATGCCGTGTTGAAATCAAGGTTCTCTCGGTAGTCAACGTCGA
CTCCGTCCACAGCGAGCAGCATCTCCACGACGTCAGTGTGGCCCTCGGCACTCGCGGTCGTCAGGGCCGAGTCATAGCCGTCGGTAGCGTTCACATCTGC
GCCTGCGTGGAGGAGAAGCCGTACCATCTCCACGCACCCGTTCCCGCTTGCTACCACGAGCGGCTGGAAAGTTGTATTGTGGGCGCCGCGCGAACTGATG
TCCTTGATACCCACGACCAATGGGAGCAAACGCGTGGCTGTGGCAACGTCGTTGGTTTCCACGGCACGCCGAATGGCCCGGTTCACATCGGCGCCGACCG
CGACCAATCTCTCCACAAGATCATCTTGCTCATGCGTACGACACGCGACCACCAGTGCCGAGTCGTTTGCTTTGTTGACGACGTTCACGTTCACGTTGGT
GTGGCCGAGCAGGAATTCGACAACGCCCGAGTGGCCGTACTGGATCGCTAGTAGAAGTGCCGAGTCGTCTTGGCCACCCACGCNNNNNNNNNNAAGGACT
TCGACAACGTCCGAGTGGCCGTACCAGATGGCTAGTAGAAGTGCTGAGTCGTCTTGGCCACCCACGCAGTCCACGTTTGCTCCGGCAGCCACGAGTCTCT
GGACGATCGCTGCGTGGCCGTGCCGTGCGGCAAGTCCCAGCGCCGTCCACCCCAAAGGAGACAGCTTGTCGACATCCGCGTGCGCCGCCAGCAGCGTGTC
GACGATGGCGAGATGGCCCCGTGCGGCTGCCTTCATTAAGGGCGTTTCGTCACGCGCGTCCGCGGCGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATTCCTCACCTAATTCATGA
GAGTTGAGGGGAAGCGGGCAAACTGGAGTGTATTTAGGGTTACACTATGGAAAGTTCTCTGGGTTACAACTACCGTAACTACCTGTCTCGTCCCTGAGTA
ACCGGAGTGGAGACTCAATCCCCAAGTGCCCCACCTGAGTCTTCACGCAGGTCTTGTTGAACTGGAAACACTCGGAGTGCGTCTCGATGCTTCTCAAACG
TGGCTCTCACTAGAGGCTTCGTAAACATGTCCGCCACGTTGTCTGCGCTTGCGACTTTCTTGATGTCGATCTCGTTTGCTTCTTCTTTCTCTCGGACAAA
ATGGTGCTTGATATCAATGTGCTTGGATCGCCCATGGAACTCTGGATTCTTGGCTAACTTCAGCGCGCTCGCGTTGTCGATGTAGATCGTCGCGGCTGCT
GGGCGACTTCGAAGCAGCTCTTCCACCATCATGCGAATATGGATCACCTCTTGCACGAGCATGCTTAGAGCGATATACTCTGCCTCCGTCGTGTGGAGTG
CGACGGTCTTCTCTGCTTGACTGCACCACGACACCAGACTCTCCCCGAGCTTCGTCACGTAGCCAGCTATTGAGCGTCGGTCTTCATGGCTGGCAAAGTC
GGCGTCGCAGAATGCGAACATGCAGTGCTGTAGTGGCTTCTTGACAAACTTGACTCCTCCTAGGACCAGACCATAGTCCGTTGTGCCTCGTAAATACCTC
AAAATGTGCTTCACAGCCTTCCAATGCGCAATTCCTGGGTTGGCAAAGAACTGCGTGCACTCGCGAACGGCGAACGCGATATCGGGTCGCGTCCCTAGCA
TGAGGTATATCAAAGACCCCACTGCTTGTCTGTACGGCTTGTCTTGCATGATCTTGACCTCTTCCTCTTCACTCGCGCATAGAGCCTTGGACAAGACTAG
TCCTGGGTTGAATGGGACACTGGTTGGGTTGCACTTGCTCATGCCATACTTTTCGAGAATCTTCATTGCGTACTTGTGCTGCGAGATCTTCAGCAGCCGC
TTGCCGCGATCTCGTTGGATCTCCCAGCCTAAAATGTAGTGAATCGGTCCCAAATCCTTCATCTTGAACCGCGACTTGAGCGTTTGCTTGAACTCGTCAA
TGACGTGCAGACTCGGTGCGTACAAGATCAAATCGTCAACGTAAATGGAGTGAAACACGGTTCACCATGAATCCATTTTACGCCAACACACGCTTCTGTC
TTGAGCATCTTGAATCCCTTCTTCTCGAGGTACTCACGTAGTAATTTGTACCACACGCGTGGCGCCTGTTTCAATCCGTACAGGGACT