Description :
From Genome Similarity Track
Location :
Scaffold_1636:2474- 3891
Sequence
1417 bases(100 bases per row)
GACTTAAACACCCACTCCAGCGTGGAGAAACGCGTGTAGCGTCTTTCCCGCCAAGAGAGTGTAGCACACTTTCAGCAGTTGTAACAGCGCGACTACTTCT
TTCTCAGCGGGATGAAAGCTGAGTTCATTCTCCTATAGTACGCGTCCGCAGAAGCGAACTGGGTGCAGCTTGTCGTCGTGCGGTTGCATCAATTTACTGC
TCAGTGCCCACTCATTGGCGTACAACATTATATGGACTTCTTTCGCCGAGGCGAAATGACGCAGAATTGGAGCTTCTGCTACCCGTCTTTTGAGCTCGGC
GAATGACGCTTTTGCTGACGCCAAGTCACCCCCAGGGCCAAAGTCCGTATCCTTGAGCTGATAGAGTACTGCTCCGTAAACAGCTAAGTTCTGGATGAAT
CGGCCGTAATAGTTGAGGGCACCGAGGAAAGCTTGCATCCCCTTCTTTGATTTCGGGAAGGCGAGCTCGGCGATCGCGGCTATCTTCTTCGCATCAGCGC
GTATGCCACTCGACGTAATCTCGTGCGATAGGAAATCGACCTTGGGTTGGACAAAGATACTCTTGGTAAAGCTGATGCTAATTCGACATTCTGTGAACCG
GGCTAGTAATCGGTCGAGTGTCTCCAAGCAGGCGTCAAACGTCTCCCCTCCAAAACAGATATCATCGACAAACGACCTCCGGAATCAAGGAAGACTGGTC
TGGTTCTCCATTAGCAAACATGTCGCCGTCCGGTCCGTTGACCAGGTCTTGGACCGGATCGCAGTCAGCTTGTGATTGGTGGTCAGCTTCAAACTTCGTC
ATCTGACTCTGCGTTGAATCACTGACTCCGCCGAGCTCGACTAGCCGAGTTCCCGACTCGGCTTCAGCAATAGTCATTCGTTCGGCAAACAACTGCCATC
CTCCCTTTGGCTGAACGTATCCCCATAGAGCGCTGTCGATCAGTCGCTGGTAAATCATAGGCGCATTCTTCAATCCAAACGGCATGCGTAACCATTCAAA
GTGTTCAAGTGCACAGACGAACGCTGAGATCTGCCGAGCTCGGCGTGTCATTAAGACTGCCCAGAATCCATTCGCAGCATCAAGCGAGCAAAACCACAAG
TAACTCTCCAATTCGGTAAGTAGGTCATCGACTAGTGGCATAGCGTATTCCATCGGCGTCGTAACCGCATTAACTAGTTTATAGTCAATGCATAGCCGAA
TATCTACACCATTTTTCTTGAGCACTATCACCACTGGCGAGGCCCAAGGGCTGCCCGAGAATGATATCAACCCAGCTCGAAGCAGCCCCTTCAACAACTC
GTAAAGTTTGCTCAAGTGGCGGAGAGGTATCCGCCGAGCTCTCTGCTTAATGGGTGCGTGTCCTTGAACGTCGATGTCGCACAATGCTCCGTACGCTGGA
GGCGGCAGGGCATTACC