Description :
From Genome Similarity Track
Location :
Scaffold_19:247383- 249726
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007650Similar to infB: Translation initiation factor IF-2 (Salinibacter ruber (strain DSM 13855))
Pytul_DAOMBR144PYU1_G007649Similar to ctdspl2b: CTD small phosphatase-like protein 2-B (Danio rerio)

Sequence
2343 bases(100 bases per row)
TCGTCCTATTCAAGCGTCAAACACATACTAATTAGCCACATACACACCCGGAAGCCTGCATTTGTGGCGAGCGCATTTACCTTTTGTCTTTTTAAACCCG
CCCCTCTGGAGCGCCTCGGTCGGATTCTACACATTGGTCATTAGATACATTCCCTGTTTTTCAGCAATTCGCGCAATATCCACGCACATAGCACAGATAA
TGGAACTTACCTCTTGGTCTAATCGATACACATACACAGAAGCAATACACACACCGATTAGTCAGCGCACACACCATTAGCCGCCTCCCGTCCAACAGAA
AAAGCACGCGTTTGAGGACGCACCTGGGACCCATTTCGAAACGCTGAGGTGGCCGACGGTCTTGAGCTGCTTGGTCCACTTGCGCGTGCGGATCTCGGAG
ATCGGGACGCTCGGCACGTCCACGATCTGGCCGCCCGCCTGCTGCGACCGGCGCGACGTACGCAGCGACATAGTATGCTCTTGCTTTTTTTGTTTCGCGC
GATTTCGTTCACTCAGATTTGTAAAAACAAAGTACTTTGTTGTTTCGCTATATTCCGCTTTTTTATAGATAGCGTACTTACCATTTAAAGAACGCGAACG
TAAGCGCACCTAACGCACAGTCGTCGCGATGGATGCGCTAAATCTTTGGAAGGCGCTTGGACTCACATCGCGGCGTCGTGAGAGAACAATTTGGTGCATG
CGCGCGTGTGTGAGGAGGATGCGCTTTTTCGCTGCTGCACGCGCAGATAAACATGCGTGCGCACTGGCAGTCAAAGCAGACAGGAAGAATACTTGGGTAA
AACAGGCACTTGCAGTTAAAGCAGCTGGTGCTAGTGGACGTTCTGTTGGCTTGCAGTACTGTACCCTGCACCGGATGCAAAATGTGGGAAAAGGGACTCG
AACGGCGCCGTTGGAGACGAGGAGTAATATGTAAATGACGAAGCGAATTAAATGAAAGACCAAACACAAATGCGCACGTTTTTGCCATGCCGCCGTGTCT
CGTGGAAGGATGGAACTTACGATACAAAGGAGACGAGGGCGTGCGGGACGTACATACCATGTAGGCAGTTAGTTGTTCACGTGGGCAGTTGAGCGATGGC
ATCACCCGCGTTTGACGCGTGCGTTGTCTCTCGAGTCATAGGCACGCGGCCACACGCCACCGGCACGTGTCTTTGTATGGGGATGACTCCGGGAAGGACG
GGTCATGACGCGGGAATGGTGGCTATTCGGCCAGGACAAGCGGTCGGTAACCAATAGGATAATCAGGATATGCCAGGTATGGTGTGGAAGGATTTACACG
GAAGATGAATGTGGAGGAGATTGGCGCCGTTTGGAGCTGATTTTGTTTCATGTTGTTGCTTTAGAATATGGGGGTACATGACTGCACTCTACTTTATATA
ATACTACAAACTATCTACTAATACTGGCAAAATAATAATCTTCTTCTCTTCCAGATGCGTTTAATATACTTGGCTTCTTCATTGTCGACGACGGCTTGTT
GACCCACACACACACACTCACACCACCACATAGAGGAGGACACCATGGGGCTTTACGACAAAATCATGCGCTGATGCTCGGCCAGCAGGTCGGCGAGGCG
GAACAACTGGTGCAGGCGTGGTCGCACGTCGTCCAGCTCGCGCAGACTCGTCAGCACCTTGGTCAGCGACTCGAGTGTGCGATCGTTCGCGTCGTCGTAG
AAGCTCGGCACAGGGATGCCGTTGCTGGGCTGCATGAGGAACGACACTGGGTTGTTGTCAACCAGAATCACCTTGGACAGGTCCTTGCGTACGACGCGCA
GGTCCTTCAAAAACATTCCCTTGCGCTGTTGGCACGACTCGCGGAAAAAGCGGCCCGTGAACAGCGTGCCCTTAGGATCGAGCTCGTCGAGGATCGGCTT
GCCGTACGCCTCCAGACCGGCCGTGAACACGTACACGTCAAAGTGTTTGCTGGCTTCTTCCAAAAACTTGTCGAGCCCTGGACGCTTGTGCACAATCGCG
CGCTCGCCGTCATCCATGACGATTTCGAATGAGTCATCGTACTGTGCCAGTGCCGTCGGTCGGTATTCGCTCTGTCGGTACTCGACCTCGTTGTAGAACT
TGCTGTGCACGAGGCACTCGTCCATGTCGAGTACCAGCGCGATGCGTTCTTCCTCAACAGGCGAGCTCGGGACCGAGGACGCAGCGTGGCAGCCGCTTAG
CGGACGTGCTACCACGGGGGACACTACGGTCGATGCCGCGCGCACCTGTGCGTTCATCTTCTTCTTGGCTGCCGACACGTCGTCCACCATGCATGAGCGC
GGCTCCATCGGGTACTGCGCCACCGTTGCACTCATGTTCGCTA