Description :
From Genome Similarity Track
Location :
Scaffold_105:24736- 27066
Sequence
2330 bases(100 bases per row)
CGATCACAAACCCCATTCCCAACACGGGCAAGTTTTCTCTCGACACGAGTCCACCGAGAAGAGTGCAGCCCGCCCTACCGACGGGTTCACAAGGTGAGGA
AGGAAATACAAGGCACGCAAACGGAGTACCCCCTCCGATAGTCGGTCGTCTGGGCACCAGTGGAGAGTCGGGATTGCCTCATAAAATGAGAGATCGCCAC
TACATCACAATGGTGCGCGTGCCCGGATCTTCTGGTGACTCGGGATTTCACCGTGAGTCCCTGAGTGAATATGAGAAGGTCAAGGTTGAACCTGGAATGG
AAGCGTATGAGGCGGAGGGATCGCCGTAGACGCGTGATTTAAAAGATCGCCAAATCGTCAGAGTTTATGGAGGGGCTCTGATGACAAGAAGATTAAAGAG
GAAGATCGATCAATCGATCTGGAAGAGAAACCTCGACCCCCTCCTGAGGTCCCTTCGGGGACCACCGCGGATCGTGCTGCAGAGAACAAGCCGCTGGGTG
AAAACCCTTCAGCGAAAACTGAACAAAAACTACACAAGACCACTCAGGCAATGTCGAAGAAGAAGTTGTGAAGACGGATCGAGTGAAGAAAGAAGAGCCC
AGATCGGATCAACACGATCGTAGTGTGAAATCTATCAATCGACCGATCAAGTTCGTGGACGATAACATGAAGATGGAAGGCTGGCAGTTGGACCAATTGG
CGCAGGGATATCACTGGAAGGCACTCAAGAATCTGCTATCGAGCGATCCAGTGCTCCAGATATTGAAGCCCAAGCTGATCGGAGAGATTTAAGATCCGAT
ATCCCCACCGACGGTGACAAGTAACCCGCTGGACGGGATCAACGCGATCATCCAGCTACTAAATGACGCTGGATACGTTGCTGGAGTGTTAGACGCGAAC
AAACTGCTGGATTGCGATCAAGATCAGGTGAACCACGCGTGTCGATCGCTATATAACAAGTTGAACCCCCTGACGGGTAAGTGCGAATACACAGATCAAG
CTGCCACTACGATCGCCGACTTCCCGAGAGGAGACCGGATCGTCGCAGTACGCCTCGGTTGATTCTGAAATGGAGTCGAATGATTCGGTCGGTATTCAGC
GGATGTCTCTAGGCACAAGTGGGGCAGCACATCTACGCGATCGAGTTGAGACGATCAAGATCGAACCGCAATCGACGATTACATGCGCTAAAAGATTAAT
GACGTCAACTATGCAAGGACACCTGCGGACGTACCTCGATGATGCCATAGAGCGTTTTCATCAAGATCAACGGGAACGAGCGTACTAAGCAATCTACCCA
AGCCAAAGAATCAAGCCGGCAAGAGTCCAAGAAACATATACCCCAGATGTTGAGATGGAATCGGTGGGATAGCATCGCAGTCGATCTAACATTTTCGATC
GTGAAGATGCCGATCCCGACGGTTTGGGACAAGAAGAGTGGTGCGATGGTAGCCACCACAGAGACGTTGCAAAACGGTGGTGGTATTCCCCAACGCATTC
GAGTGTCAGCGATGACGGAGCTGAAGGAATTCAGTGGTAAAGATCGAGACTAAGATCGGGCCAGAAGCTGGATCAGCAAGGTCAAGTCAGCGTTCCTGCG
CGATGAGACGCCAGATAAAGAAAAGTTTTTGGTGTTCGGTGATCTGTTGACGGGACCCGCGCGAAATTGGTACAACCAACTGAGCCGATCTACACGGCAC
AATTGGAAATCATTGCTGGGTTGTTTTATGATACAGTATGGAGGGCAAGGTGTGTTAGTGGCCAGACAGTATTACCTCGCACGGAAGCGATCCGATGAAA
CCTCGCTGGAGTACTTGCATCGTCTTAATGTCGCGGCCACGCATGCCAAGATCGCGAGTAAAGAAGAAGGACTGGCTACATCGGCCACGCGTCGCGAGCA
TGTGGAACACTTCATTGCTACGCTGGATGATCGCGATCTGGCAAAACAGCTGACCTTAATGCGATTGATGGATATTGATGAGATAGAAGAAATTCTCCTT
GCGTGTCACCGGACGGAGAATCGTCAGATGAAATCGTCGATGGGATCAAACAAATTCTATCAGCGAGCGATCGCGGCTGCAAATTCGATGGCGTCCAGCA
CGACTCGGGCGGTGCGAGCGATCCGCGATAAAGTAGAGAGCAGCGGATCGGAATCGGAGTCAATTGGATCCGAGGAAGAAGTGGATCTTCGTCGTGTTTG
TGTAACAACTACACCCAACCAATAAAAACCGAACAAGGATCATCGCACCTGGCAGAAGAACACTGGTGAAGGGGAGGGACGCGATCGTAGTGGACGATCG
AAGGCGTGCACCCATTGTGGATCTACCAGA