Description :
From Genome Similarity Track
Location :
Scaffold_284:24735- 27779
Transcript NameFunction/comments
Hyaar_Emoy2813501hypothetical protein

Sequence
3044 bases(100 bases per row)
TATTCCTAATATCTGGGTCAAGGCACTGCATGCACGATCTTCACCATAGACGGATGCTTCACCTCTACTTTCGCACCTGACTATCACTTTCCTCTATGCT
ATGACCAGAAATAGTTTTTCTGCCTTCGTACAAGGTCAATCAAACAATGCGTTACATATGAACTAGAAATGATGTCCTGATTCTTTTCATTACCATTCCG
ACCGATCGGGGTTAATTTGCCGTCGTGTCGTTCGTTTCTCTGAACAAGGATGTAGCAACTCATTTTTGGCTATACCACATCGATATAGAATCATATTTAT
GGATGCTAATGTGCTGTGTACATCAAACTCTGCTTGTAATTGCGTATGAATACATGATCGTGTCGTCAAGAGGTTCTGTAAACAGGTACATTATTGTCGT
TGAAACATTCGATCGTAAAAGAACAGAGGCGGGTCATCGTGTGTCGTATTGGTAGTGTAGTGTCGCACTGATCTGTTCTGTACATCATGGATAAGAATAG
TGTTCAGGTATCCAATAGGAACCGAATATGTATAGGGGTGAACAAAAGTGTATGAATGGATCAAATTAATTACATGGATCAAATTAAGTACAGAGATCAA
ACGGAGTATAGGGATCGAATCGAGTACAGGGATCAAGTCGAGTATGGGGATTCAATTACGAGCAGAGATGTATCTAGTGTGGGACGAAATATTAAGCAGG
GATCAAATGTAGTATAAGGAGCTCTATAACTTCTCATATCACTTCACACACTCACGCTGTCCTGGAATAACGACAGCGGACGTTCATCAACGGAGGAGGC
CAGTCCCAAAGTGAGCACAGCACTACCATCGACATCCCGAGTCAATGCATGAAGTCGAATACGATCATCAAAGTTAAGTAGGTTGTATACTATTAAAGTC
AAGTAGAAAAGAAGGTTTGTGTATTTTACCTGCTATTGACCTCTCCACGACTATGGAAATGGTTATTTTGCACATTTAGCAGAGGGACGAAGGAAGGTTA
CATGGGTTTTGCGGGCGGTGTCCTACCTGGACAGTGCCCTGTCTGTCATAGAGAACAGCTCGAAATAAGCTGGTCTCTGTGACCAATTCATCACCGCGTA
TATGGTGGCTGAGTAGACCTGAGGTCCCTCCGTACTCGCGTGGCACTCTTAAAGCCGCCACACGCCTTTATCGATCCCTGTGTTGCAGTGACAGGTCCAG
ATTAGGCAACGGGAGAGCACACAGTAGCTAGAAAGTAGAAGGTCCAGCCCACGAGCATCATGCTTGAGCAGGTACAGCTTCTCCGTGTACGTACTGAAAT
TAGGTAAGTGTACCGATCCCAGCCAGACACATACAATCGACGCTAATTACACTCTCCACCCTTCAACCGGTGCTCATCATCAATCGGCCGGTACTTAAAT
ATCTTGTAGTAAATGCTGGATTGGAGCGAGTATTGACGATCCCCAGCAGTATGAGTTTCAAACGTGACGGACAAATAAGCAATCACCACAGTCTTGGCAG
CCACGTTTCGCAGCACAATATCCAAAAGCGCAAAGCCGCAACAGTGTACTCAGGTATAGACTGATTCAGGCGTAGCTCTGCGCCTGACTTGTTCCGTTGT
AGAGCTTATCGTATCGCAACACCAATCTGCTAGAGCGCGGTATCATGACGCTGGCGGATAGCATCCAAATTGGTTGAATAATGATTAAGCGCGTGGCCAG
CGTCTTATCACTCGAGCAGCCATCTTTACGACAATAAGTATTCGCCTTCATACGGCGGCGCTTCCGCAATAAATTCGTATCCACAGAGTTGAGGCGGGCT
ATAATCTCAAATCGATGTTTCGCATCCTAAAGGCCCGCCCCGGACATGACAACCATGGATCCAATACCACTATGGACACGAACAGTGTATCCCGTAGTCT
TGCATACTCATTCACCGGGTCTAGTAGAGGGTCTTCATGTACAACTTTAAGTACTGCAAAACCGTTTTGTGTTCCAACGTGGTATTTTATGTCGTTGAAT
CTTTGATAATATAGTTTCAATGCAACAAACACAACAACCGCTGAGTAAGTCGGCCTAGTTGTGCTAGTAGGTCGGGATAAATTCCTCCTCTATTTCCCCT
CTGCTTTCAGATGTGGCTTTCGCCCTCACTGACTACCTGCAACCACTCTCTCTCCCAGAATCCTGCCTGAGCACAGCAGATTACGTTCCTCAAATCCTGT
GACCTCACACCAATGGATGGACGTCGGCGTTTTCACGCATTTACAGGTCACTGGGCGCAGTATACGTCCGACTTAGAAGACGTACGCTGTCCTTGGTTAA
AGACCTACCGGCACGTTGCTCGACAAGACTTAAACCGGACTCTTCACTCGTCTGGCCGAAGTAGTCGCCAGAATATCTGCGTGGTGCTCTCCTTATCCCC
ACCGTAACTTCGATAAAGGTGTCTCCACCCAGACAACAGCAATCGGTCCCTGCCTCTTCCACATCCAATGCGCCAGCATTTCGGGAGGCACCTCTACCTC
ATTAGAAACGATCGGCTCCTGTATCTTCCAAGCCTGATGAACCGGCGTCAAAACGCGTCTGTCGGACCCGATCGTCACCGACTCGATCGACATCGCCCGA
TCCCTTTGGTTCTTCAACCCCGTCGCCGGAGCAATAGGAGGGCAGCGATCAAGATGATTCTCCTTTCGCAGATACAGATGATTCTCTGCTTGTGACAGCA
TCTTCATCCCGTTTTACCGACCGACGTGGAATTACGACATCTCCCTAGACATCGTCGCCAGCTCCGATATCTTCACCGATCAACATTGACTCCCCCAGTC
CGGCGAATCAACCTCTCAAAAATCCCGCGAGAATATCCATGGTGGATCTATTTGGGGAACCATCAAGCGATTCCGATGGTACCCTCATCCTTTCTGGTGA
TCCGCGAAGTTGGTTTAATTCGCTGCTGACCGCCGAGGAAATTTTGGCGCTTCCTGATACCACCGTGCCTCGCGATCGTTGGGTCCCGGGGTTTGGAGAT
CGGGTTCCGCGATCAGAGGTGGACGTATCCACTTGGTCCGCTAG