Description :
From Genome Similarity Track
Location :
Scaffold_854:2473- 3934
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_854-fgenesh-gene-0.1Major Facilitator Superfamily (MFS)

Sequence
1461 bases(100 bases per row)
CGTGCTGAACATCCACACAaCGTACGTGTTCACGTTCTTCTACTGGGCAGCGCGCTCCATTTTGTTCCAGCAGGTCATCGCGGGCTTTGtCTTCGTGCTG
ACCAACTCGAACCAGCCCGTGGGTGTGGTCAAGGGCGTGCAGGGCATTTCCCAGCTCGTGTTCTCGTTCCCAGCTGGGTACATCGCCGACCACACGCGTC
GCGATCGTGTGTTGCGCTTTGCAGGCTTCTTGGGACTCGCTGCcGCGCTGTTGACCGCAGTCGCCGTGTGGAAATGCAACCTCGCACTGCTGAaTGGCGC
CTTCGCGCTTTGGGGGCTCTTCGCCGCCTTCCAGTCACCAGCCATGGAAGCGATCTTTGCCGAGTCCGTGCCACACGGCCGGCGATCGTTCCCGTTCATG
ATCAAGTATAATGTCAGCAACGTCGCCATGGTGGTGGGTCCACTGCTCAGcGTCCTGCTCTTCCTCTACgTTGGGgACAACTGGCGTGTGAACGAGCTCC
AGCCcGTGCTTCTGTGTGGATGCGGCCTCGTCGCCATAGCGTCGCTGTTGTTATTCCGTTTCAATGATGACCAcAcGCTCTctGAAGATAGTGAGGATGA
GAGGGACGTCGACCTGGACGGTGACCCGCAGGCTGCTGTGGTCCCAAGAACCCACTCGCGTCGATCGCTCGATTCCGAAGCACTTCGAACGCCTTCGGTC
GCTGGCGATGACTTGGTCATCGAGTACGACTACTCcGATCACGACGACGACGCTAACACTGAAGACGACTTGGAAAGCGAACAGAACCAACTGAAAACCA
TCAAGATCTCGACtGAGACCAGCTCACTGCTGCAGtCCAAGGCCGTGGACgaCGTGCAGAGCAAAATGCCCGCGTCGCAGTTCCTGTTCTTGCGCTCCCA
CCACGTGCCGCTGCTCATCTTCTTGTCGGACTTTATCATCAGCAACGGGgCCGGGATGACTGTGTATTTCTTCCCTCTCTTCTTCAAAGAAGAGTACGGA
TTATCTCCGATTCACGTGAGTCTTCTCTTTCTTGTACAGCCTCTCATCGTCATGGTACTGTCATTTCTCGGGCAACGTGCATCGAAAGCACTCGGTCGCA
TGCCAATCATCGTCACGACGCGCATTCTCGCGACGATCTGCCTTCTCGGCATGTCATACGCACAGCCACTCGTGCTGCAGATCACGCTGTTCCTCATGCG
AGGAGGCATGATGCGCTGCTCGCAGCCCCTTCGGCGGTCGGTTCTCATGGACTTTGTGCGGAAGGAAGTACGCGCTCGTTGGAACGCCCTCGAAGGCATC
TCGGTGTTCTCGTACTCGGGTAGTGCGGTTCTGGGCGGCTACCTCGTCGACCTCTACGACTATCGGACaTGTTtcTTCATCACGAGCTTTGTCTACTTTG
TCGGTTTGAGTCTCGAGCTCTTTCTGCTTCCACTGACAAAGCACGCAATTGAGAAgtAAGG