Description :
From Genome Similarity Track
Location :
Scaffold_3:2472701- 2475472
Sequence
2771 bases(100 bases per row)
AGACGTTGACGGATCTGACGAACGAATTGTTAGTTGTGTGTGAGAGTTCCTCTAATCCCAACAATTTACCAGTAGAAGCGTCTGAACGACATGGCACGAA
CAGGGAGACAGCTGGCGCGAAGCAGGATATAAAGGATTCTCAAGCAGCACATTCCGTTTTAAGGCAAAACGGCGAAGACCAAAAGATGGCAGGGCAGAAA
GAAAAGAGCGAGGTTATTCAGCTAAGGTGCGTTGTGCACGTATGATACCTCTCATTCTTGAAAAAACTGACGGCGGATCGTGGATGTCTTACAGAAAGAC
AGTGATGAAGTTGAAAGAAGCTCTCGATGCAAGAGACGAAATGTTACTGTTTCTCGATGGGAAAGTTAGACATCTTGAACATGTTACAAATTTTTAGAGA
CAATTAACTTAGAAATTCACATTGGCAGGGGTTAAAGATAACTACTATTAGGCTATCTCCACTCGAGTTGCTATCGGAGTTGCTATTGCTAAAATAGCGA
CGGAATCAGAAAGAATATATTCTGCTATCTCCACTCGGAGTTGCTATTGCTATTTGAAAATAGAAATTCTGATTCGAGTTGCTATTCGGACCCCCAATAG
CAACTCTGGTGCACGAATAGAAACTCACTCAACCGAAAGATCGCAGGCGCCATGGGGAGAGGTCGGAAGTGGTGTGCTCAGGAGGACGAAGCTCTGGCTC
GCGCGTACAAGATTTCTGCGGAGAACCCAATACAAGGAACGGACCAAAAAGCTGCTGCATTCTGGGAGGATGTGTGCCGGCACACGGCAGCAGTATTCGA
CGGTGAAGCTCGATCTCTACAAGCCGTCAAAAACCGTTGGAGCATCATATCACACGATGTAGCAAAGTTTTCGGGGTGTGTATCTCGTGTAAAAGGTCGC
AACGAGTCTGGTAAAAGCGAAGACGACTTGACCAATGACGCCGGCACGTTGTATCAGGAAACCCATGGTAGTAGGTTCGAGTTTTTGTCGTGCTGGATGA
TACTGAAAAGCTGTTCCAAGTTCACGGCATTTGGACTACCTGCTCATCAAAAACGTGGCCAAAAGTCATCGAGTGAAGAGCAGGAAGAGTCCAGCCTCCG
CCCAGAAGGAAGAGATAAAGCAAAAAAGGCACGACTACAACACACAGCACCAGTCTCAACTTCAACGCTGCTCCAACAACTACTCGATCACAACAGGGAG
AAAAACGAGAAGATACTGGAAGAAATAAAACGCAAAAACGATTTGCGTGATGAAGAACTTTGAGCCTTGACGAAGTGAAGGAGCCGTCGCTTGTTCTGTT
GGCTCCGCGCAGACCACAGCGAAAACAGCAGCTAAAAGATCATCGTCATCAGCGAGGAGAAACTCTTCGTCACTGCCCTCCATTGCCGATAGAATAGCCT
CCAGAGGACTGGAGTTGGTGAAAAATCCTTATTTCTATTATCGCAGCGAATAGCAACAGCCAATCAGATTCGACAGATTGCAATACGGATAGCAACTACG
AGTGGAGATAGCCTTAGAGTTACTACAGTAGTATTTTTTAATTAGGAGCCGCACCAATAGTCTATAACCATTGGTGTATTTCACACCAATGTGGAAAACC
TTAAGTGGCTACGTGTAGCCACTTGCGTGTAGCCGAAAGAGTACAAGGTGAACAAGTTTGGCCAACACTTGCATGGAAATGCCAGGCTGTTCTATCAGCA
ACACAACGTGCGCTCGTGAACCCCGCAGATAACGCTCTGGTTCTTCATGGACCAGAGGCACTTTTCATTCAAGCGGACGCTCTCGATAAAGCAGAGAGTG
ACGCAATTCGGACCCAAGAAGGACCCGTCACGATCGTGGAATGAACACTTCTTGTACTTGAATGCTATTTTCAAAGTAACGAACGCGTCACTGGAAAACA
TTACCAAATACGCGGACCCAGTCTTGAGGCACACCTTAATGACCATGTGTGGCATCATGCGGCCGTACCCTTACTTTTATTCAACTAGCAATCGATCTGC
TGGCTTGGGCGCATATGATGTTCGACGACGATTGAGCGCTATAGAAACTTTACAAGGCGGCTATGAGCGAGGTGGCTGAGTCCCAAGAAGGGACGTGGCA
ATGCCACAGGGGCAAACAGGCTGGACATATTAAGAAGAGCTGCCCTGAGTGCTTCAGAAATCAGCGAGGATAAGCCAGTAAAGTTTGCACCTGTCGCTGG
CGACGACTCCAAGTTTATGGATGCTAAGAGCTGTATACTGGACCGTGGTACTAGTCAACATCTCGTCAACGACCTCGCGCTACTGCTAAATAGCGTAGTG
GATATATCTGGTGATGACATCTACATGTTGCCGAGCGGTCGAACGATAAACGTGACCGAGAAAGGATCGGTGACTCTGTGAGCGATTGTCGATGGAGCCA
CGACCGAAGTGGAGCTCAGCGACGTCTACTACGCGCCAAAGCTAGCGCAAAGCCTTACCTCATACGGAATACTGGTTGCGAAGGAATGCTTCTGGCGAAG
CGCAACGGAAACTTGGCACTGGTGAAGAGGGACGACGTGGTGCTGTACGGCGACCTAAAGCACAGCCTGGGTAAGGGAACCATCAAGTCGGGAGCCGAGA
GCAGTGCAAAGATAGAGGAATTGATTATGAATATGGTGGACACGAGTACCGACATCGACTTGCCAGTCGTCTCTACGGATATTCTTGGTTTCCATGCACG
CTTCGGTCACCTGGCACTGCACACCATCGAGCGCGTGGCGAAGAGCCCCGCATCTGGTATCAAGCTCTCAC