Description :
From Genome Similarity Track
Location :
Scaffold_23:247228- 248251
Transcript NameFunction/comments
Physo_132901hypothetical protein

Sequence
1023 bases(100 bases per row)
ATACCGAACGCCTGATATATATAAGGGCTCTAGGTTTATAAAGTGATCTCAGCGTTACCAGAGAAAAGGTTGTACTGAATTAGTTTATATTAGACGGGAT
TTGACGCTTGCTTAGTTAATCAAACCCGAGTAAAGCAGTGCTGAGTTGTTTCAGCGCTGACCTTCGACCAAGCGTGTTCGCACCACATCAGTGCGTTTAG
TAGCTCTATTTTGTACTACTCTTAGAGGGCTTAGCGGGTAGTGCGCAAATGTGAAAGTGGAATCGTAAATACAGAGAAGATCGCACAGACAATCAAAAGG
GCGCCAATTTTCAAACTGCACAGCTTGGTACTTTTAGCCAAACAAAGGTATCCTGGATTTTACATCAGTACCTTTGCCCATCTCCGTTCCTCCTGTCGTT
GGACCTTGAAGTATTATTTGTATGAGGTTATGTATTGTATACCCGTTCGGTATTGAGGCAGATTTCTGTACATGTACAGCTCGGCTTTGAGGGGCTTTCG
CGGTGCACAACAACAAGGCGAAGACGATTGCGATGGTCGGTCGACCAAGGAGGATTTCCCTGAGAATGGGAGACTTTTGGCAGGATGGGGGATCTCCGGT
TCTCGTTGAATACACACTGGCACATGTGCGCAGAAGACCAAGCCCTCTGAAGAAATAGTGTCGCGTTCAGTTAGGCTACCTGGCACTCTAAGTCTCTAAT
AAGTCTGTGGGGGCGGGGTAGCTGGTAACTTCTCGGCGCTGTAAGTGTCGTTCGGACGGCGGCAAGTGGGCTAACTGGGGGACTGGCGAGGAGCTGCTGC
GCCGCATCACCGGTAGGTAACGTACTCGTCGATCATGTCCAACCGCCTGGTCCGCTTGGTGCGCTTGCAGTTCTCCCACATGTTCATGGTGAGAGGCACG
CTCTTGCCGCTCACCAGCGTTCGCGTTGCTCGTCGGTCTCCGAGTTCCCCGGGGATGACCACGGGCGGGGTGGCCATGTGGCGCATATGGCTGAGGCTGA
AGCGGAGCAGCTTGCCCGGGTGG