Description :
From Genome Similarity Track
Location :
Scaffold_361:24721- 27582
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_361-snap-gene-0.17RUN and FYVE domain-containing 2 isoform 1

Sequence
2861 bases(100 bases per row)
AACACGAGCGAGAGACACTTGGCCGAAGTCTCGAGTTTCCGGCGCAGGAACACCTCCGTGGTGGCCCCGGAGATCACTTCCACGAGGTCGTTCGTCTCCA
CTTTCGCGTCCGCGCGCGGGGACGCCAGCGAGACACCGCTGGACGGCGGCTTCCATGAGATCCAGCGGCAGCCAAAGTCCGAAAAGAGCACCCTCGCGTG
CGGATTGCCGCGAGACCCGTACTTTGTGACCACGATACCGTTCACGAGCTGCTGCTTGAACTGCGACAGGAATTCCTGGTCTCGGCTGTGATTCTCGAGC
CGCGCGCGCGCGTTCTCTTCGAGCCTATCAAGAGCTAGACGCAGCTGCTCTTTCTCGACTCTTTCTGCCTTGCAGCGCTTCTCGAGTGACTGGATCTGGT
GCTGGAGTTCTTCATGGGTTGACGAAGAGCTCTGCTGCACAGCGAGGTGCTTGGACTCGAATTCGCTCAGCAGAGCGCGCTCGCGGCCTTGCGCNNNNNN
NNNNNNNNNNTATGCAGCGAGCCAATTTCGTCGTGCAACTCGACGCTTTTCAACGTCAGCGCCTCGACTTCGTGCTCGTAGGTCTGTATCATCTGCTCAT
AGCGGGAAGACTCGACCAGGAGCTCATCGCGCTGCTTCTCGACTGTCAANNNNNNNNNNGTCTCGCAGGTGCATGAGCAGACCAAGGTACTCCGTAATTT
CACCTGATGTTTCCTGCTCGCCTCGCCGACCTAATAAGAGCTGGTCAAGCTCTGAGCTGGTACTCTGAGTAGCTTTGATACCCTGCTTGAGTATCGACAA
CAGCTTCGTCTTCTGGTCCAGTTCCTGAGTGGACAGCCCCAACCGCTTCTCCACATTTCGTTGCTGGCCCTGGGCTTCGACGAGTCTCGAGTGGAGCTCT
TCGGCGTGGTGCGACGAGTCCGAGTGCTCGAGCCGGAGCTCCTTGCACACGAGCGAGAGCTCTTCTTTTTCATGACGGAGGTCGTCGACCAATTTCGACA
TCTCCTCACAAATGCAACCTTGGTCGACCATTTTACCCTGGAGGGTAGAGTGCGATCCAAGCAGCTGGGTATGCGCTTGTTGGAGATGCAAAAGCTCATT
TTTCGCCAAGTCAAGCTCACTTTTGAGTCTCGTGGCTTCTCGCTGCTCCTGCTCGACCGTGTTGAGCAGCATGTCGCTCGTAGACTGGCGCTGACTGGCG
AGAAGCCGGTTCTTTGCGATGACGGCGTCGCGTTCCTCACGGAGCCTGAGTCTCTCAGTCTCCAGTTTCTCCTTTACAGCAGCGATCGCGTCGCGCTCCT
GCGTCATGCTCTCCTTCTCAAGTGCGATGCGGTCCTTCTCGCGCTGGAGATCGGCCATTTGCTGCTTGACGCTAGCCAACTGGTCACTCACGTCCTTGGC
TTTGAGTTCGAGGTCGCTCGCCAGCGCGCTTGCGGCTCCAGCTCCAGTGTCAGCACCTCTTGCTCCCCAGCCTCCCCCATGCAGGAGTACGACGCTACTG
GTGCTGTTACGACGAGTGATAGAAGTCCATTTGACAGGGCCGCTGAGTCCATCGCCACCAAAAGAACTGTTAGAAGAATCTGGACCGATGAGCCCTCCCA
ATGGTGCGCTGAGCCCGACGCTGCTGTTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCAAGGAACAGAGTGCTGTTGCTCTGTTGGCA
GCGAAAATTCGGGGCTTCGAGACTCACTGCTGCGGCTGCTGCTTTTGAAATGGGGATTCGCTTGGACGAAATGTCGGCAAATGTGAGGAAGAACGCCGGC
ATCGCAGCGCGCATCCTGTCCATCACAAGACAATTAGTACTCACCACTACAACTAAGCCACATGGATATGGAAATACCAGTCATTCTACGTACTTTTGGA
TCACTTGGTCGTAGGGTACACCCGCGACGTCGTCGCTGTTGACTTTGCGCACGCGCAGGTTCTCGCGAATGAGCCGCGAGTAGTCGCCAATGCCTCGGCA
GCGCGCGTTGTACTCGGCGGCGAGGCTGTTCGGCACGATCTCCTTCACGAGGCACTGGTAAAGCTCCTCATCGTCCTCTTTATCAAGGTCGAGATCATCG
CACGAGTCCTGTGAACCCGGCAGATCTTTCGAGCGAGTCGACCCGAACGAAGCACCTTGTGAGGTCGCATTCGTTGGCGGGCGACACACTAAGCTACTCT
TCTTGTTGGCTTTGGAGCTGTGATTGGCGCACCGAAAGCCTAATCCCGTGACTCTGGTGCCATCGAAGAGCACGCGGAACTCCTTCTCCCACTTGGCGTC
CTGCACGTCCAGCAGAATCACCTCGAGCGCCTTCTTCTTGAGGTCTTCCTTGATTTGCTCCTCAGAGATGATCGCTGCTGTCGCTGAGGAAGAGGAAGAG
AGAACGGGAGTCTCGGAAGAGAAGAATCCGGAACAGAACTTGAGCATCATGCTTCTTCAGAAGACGGATGCGCCTCTCGGAAATGAACTCGGAATGGAAA
GGAGCCTTGAAGACCCATGGTGATAGATGGAGATCCTGTGGTCTGAGAGCCAAAGATAAATACAGAGCTCCTAAAATTGTCATTTCGTTCAGGCTGGAGA
TTCTGGTTGACGAGGGAAAGCCCCCATCGCATGAATTGGTTCATCTCTCTTTAAAACTGCCACTCCGATTCTCTTTCTCTGGTCTTCTTTCTCTCCATCA
ACTGGTTGGTTTATTATCTCTCTGCGGCAGGAGCTCGCCTCGTATCATTCCTTCCTTTTCCTCAATAATTAAAGTACACTGTCAAAAATTGACGCACTTG
TTCTCAAAATCCCATCCATTCTCCTGCTTCGCCTCGCTCTTACCATTCGTTCTCCGTGTCT