Description :
From Genome Similarity Track
Location :
Scaffold_1527:2472- 7520
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1527-fgenesh-gene-0.0Ras-specific guanine nucleotide-releasing factor
Pytiw_DAOMBR242034maker-piw_contig_1527-fgenesh-gene-0.1Drug/Metabolite Transporter (DMT) Superfamily

Sequence
5048 bases(100 bases per row)
ACGTGGGGACAAGGATTCGGCCGCGTGGCTCTACGGCTGCCAAGTGAATATGAACGAGCTGTGCTCATGGGGGAAAGCCCGCGGGAAGCAAGTGTTTGGC
TTCAAGCCACCTTCGGGTAAGAGCGCGCCGCTCTTCGCAGCGGCGTTCCACGGCCAAGGTGAAATGGTCAAGTACCTGCTTGGACTTGGCGCAGATCCGA
ACGTCTTAAACCGGAAAGGCAAGAACCCGCTGCACATGGTCGCGTGCAACATGGACATGGCCATCATCGTCGAAGCTCTAGTGAATGCGGGGGCCGAGAT
CGATGCGCCCGACAAGAAAGGGCTCACGCCACTGATGTGGATGTGCTCTCGCGGTTCCATGGAAGGCGCCGCGACGTTCCTGGCACTCGGTGCTGATATT
CACAAGACGGCGTGGTCGAATGGCTTCACGCCGTTAGAGTTCAGTGTGGCATCGCGGAAACAGCAGCTCGTGGACATGTGTCTGTCGAAGGGAGCCGACC
CGAACATCCAGACGTTTGAAGGTGACACGAGCTTGCATATTGCTGCAACGAACGGAGATTCGGAGATCATTCTCCGGCTTATCGAAGCTGGTGCAGACGC
CAACATCCAAAACCGCTATGGCCAAACCGCTGCAGCGATCTTGCTAGCGGCTCCGCCCGGTCACATCCCAAAAGAACGCGTGGTGCTATGTCTCGAGATC
TTGGCGTGTGCTGGCTGTCGTCTCGACAAGCGGGACATGTTTGGTCGCCAGGTGTTCCATTTGGCGAGTCACCTGGCCGACGAGCGGTTGACGCAGCTGG
TCCAAAGGATGGCTAGGCTGAGCATGTCCTGTGACGAAGACATTGACATCTACGGATGCTCAGCTAATGACTACGCTTTCTGCAACGAGACTGCTGACAG
CGACATGTCCTTCTTGATGTCCCAGAAACCCCAAAATTCGTGGAAAGTGGCGGATGGAAGGAGTGGCGGCAAATCGTTGACAGCTCGGTCGTATCGTGTC
GATGACCTTGTCAACAGCCTAGTGAACGACGTCACAGTGGACTTCGCTGAGATCCTGTCGTTTGTCCTCTTTCTGGAGAGTTTCTCGAGCCTGAACGAAG
TCGTCGAGCGTCTGAAAGCCCAAACCTGGAGCAAGGAGAAAGGTGAGCTTGCTGTGTACTTTCCCTGATATGTCGTTCAGTTGCTGACATGAAACTTTCG
TGATGGCAACTATGTGTCTTCGCAGGTCGAGGTCTCATTCGACTGTTCGTGATGCTCCTAATGTTCAAGGAACAGCACGTAGCCGACTCGGAGTACATCC
ACGACCGCTTTTATTCGTTGATGCAGCAATTCACTGGCGTGGACAAAGAGAAACTCGCGTCATTGGTGCAAGACTTCAAGGGTCTCTTTCACGAGTACCT
CGCTCTCCGTGGAAGCGAGCTTTGCCTGAAGCAATACAGCGACGCGTCATTGGCGATGGAGGACATGTACAACCCGTACACGCACGATATCCAGGAGTCA
TTTCCCGCAACGCTGCACCGGTACGGAGTGTGCCGCGATAACCTCATTGCACTGATGCTTGTTGCTGGATGACTGACTTCTCTGTTTGTTATGCCGAGCA
GCAACACAGAACCGTCCAAGTGGGCGGAGCAGTGCACGCTTTTGACGCATGCTCTTTTCACCAGCATTCCAGGTACGCAATATCCTTGATTGCTGAAATG
CTATGTAACCCGGCCAACGTGAGTAGTGACACTTGATTTTTTTGCGACCCAATTATACAGTTGAGGATTTCATCAAGTCGTCCAAGAAGAGCTACAGCTC
CCAGTTCCTGTGCGCGAGGCGGTGGTTCCAGCACGTAAGTAACAACCGTGCTGCGGATTGCCTCATATAAGTGAAGGGCCGAGATCTCACGTTTCTGAAT
GTGCCCCTATTCAGTTGTCTGCGTATGTCATCAATGCCGTACTCCTGCAAGAATCGTCCCGGGAACGCGCAGAAGTTATCACCTTCTTCCTTTCGGTAAG
CTCAACTCGGTCGCTACGAATATGAGGGTCTATCGCATTACTAACTAGTTCGTTGGGTTGTCGCTTGATACAGGCCGCAGAGTATTGCTTGTCACTGAGC
AACTACGACACGCTTGCTGCTATCTTGTACGCACTGCAGTCAACTGCTGTCCAGCGTCTTCGACGCACGATCGATCAGGTCGGTTTGTCTGCGTGGCAAC
ATTCGTATGTTACTTCAAGTCATTCTAACGGTTTGGTAATTTTTGATTGACACAGCTGAGTGTTGCGTCGAAGAAGCTGCTCAATGAGATGCAGTTTCTC
TCGGACAAAGGCTGTCGAGAGATGAACAAGAGCATGCGCAAAGCCTCGAGTCCGTGCATGCCGTACATCGGACTCTATCTTCAGGTAAGAGCAACTGTGC
ATGGTCAAGACTATGAGAGTTGGTCTGGGTGCTGATATTTATTTCTTGCACAGAGTTTTGTCGGAATCAACGAGCTACCGGTCTTCGAGAAACCGGGTCT
CGTGAATGCGAATCGACTGCGGAAAATGGGCGAACTGGTGATGGAAATTCTTCGGCGTCGATCGGTTCCGTACGCGCTCACATTCGATGAGGACACCAAT
GTAAGTTTGGAAACCCTGCAGCGCTTGAGCACCAGGTTTGCCACCATTTTACTGATTCCATTTATCCCTTTCTTTTTCAGAAATTACTCCACGTCGCCCT
TCCCTACGACTCGGACGAGAGTCGGTATGCTCGCTCGTTAGTGTTGGAGCCTCGCGAGGCTGGCGCTGCTCCGTTGAGTGACCGCTCGTCATTGACAGTT
GAGGATCTTGACATCGAGAGTGAAGTGCGAGGATCGATTGGCTCGGAGGGGACATTTGGCATCCGACAATGGCTTCGAAAGCAGAAAGTCGTGCACCGGA
ATCGTTCTCGTTCGTCTGCCCAAGTTGCCCAGCACGAGTGGGTTTAGACACAGCACACAGATTCTGTTGTAGTTTGGCAGAGTTTGTAAGCATCACAGTA
TTTAATCCCTCCAGCATCAGTGCAGCTTCTTCCCATTGTATCCGAGTGTTGCTTATCCTGCCATGCATCTTCTCGAGTTGTTCAGTTCTCCGAGATGTAC
TTCTCAAAATCTGCCATGGATGACAACGCGAGCAAGCTTGACTCGAGTTCCTGAATCAAATAGATGTAGCAGAAGTTCATCATGAGAATATACTTTTACA
TCACATAACTGCACACACAGCAGTGTTACCTCATCAGCAAACAGGTCACCTGACTTAAGCACCGAGTGCTTCTTCGTTTGACTCGAAGAAGCTTCATCGG
AGGTTATCTCTTCCATCTGCTCCATGATCCGATCACCCTTGGTGCCGAGCATGTAGTCGTCTCTGTTGAAAAGACAAAGTAAAAAAGCATTCTAGTTAGA
CAAATGGCTCGAATTTGATCGGCATTGGAGAACTCGTGCTCTCACAGGAGGCGGTTCAGCTGAATGCTTTCGGTTGAGTCTTCTTGAGGAGCGTCACTCA
AACCTTTTGAAGCCTGGGTTCAAAACGAAAGTACACATAAAGCGTGACAACGTCGTTATGAGCCTGGTAGATATGTGGAGGCCTATACACACATGGCAAC
GGATTACCTCGTTTGCGTTCAAGTCGTTAAAGAGCTCTCCAGCGCTGCCAAGCAGCATTTCTCGTGCAAGGGAGCTACGTTTCGTGGTTTGAACAAGATG
ATCACGCTCGTTGACCTTGAGCTGGCGAATCTTGTCCACGGCATTTCTTGACAACAACAGAAGCCATAGCAGCACATAACGTTAATATGCCACTGAACCT
TGATAGTTTGCAGCTCAAGACAACAGCTTACTCGTCCTCGTTCTCGGTCGAGAACATACCGCTCTCAGTCGTGAAGCCATTCTCCTCTGTGTTCGACTCT
ACATCGATACAGGTGGGCGCAAAGTGCAGTCAACAACTACCTATAGCGATCGTCAAGATGTAATTCGAGGCAGCTTACCGATGCGTGCGGACGCAACATA
CCCGTCGGTCCGTGCGGCATCAAAGAAAGCAAACGCTGCATTATAGATCAGATAACATGAATGAGCACGTTGGGTCCATCGTTCCAGATCCAGCCAAAGC
TTGCGGTACTCACTGAAGTCGCGCTTGGGTGGGGTCGCCATCGCTGCTTTGCTTGCGTCCATGAGGACAGAGCTCTTGCCACACTAATACAGAGACAGCG
CGGTCACCTGGTCCTGCACCTGTGGACGTGTCTTGTGAACTTAATGGGGCCTTTCAAAAGATCCGCTTTTCACCAAGCGCCTTCGGATTGGCTGAAAATC
GTCGATTATAAACAACCAATCAGGACATAGATTGAAGCAAGAATGATGGTCTCTTGGTTTCCTTTCTTGCGCCAGTGCGGGCTTGGCGCCTCGTCCTGGG
GATGGCCTCCATGCTGCTCTCTCTCTCGCTCTCTGTGTCATCTCTCTCATGCTCATTGGCCGTCTAGACTCTGTGTAAATGTGGCTCTGCTGTTCACGAC
TAAATCTGACTGAACGGCTATAGAGGCAGGCAGCCAGTTGGCCGAAGTCATGGACGCATTGCTTTCTACTCGAATCAGATTATATATTTACACGTAGTGG
ACGTCGCCGCGCACGACTAATTTCCGAATCTCGGCAGCGGTCGTGGACGTGAGCGACTTGCCCTCCGTCTCGTCGATCGACCCGGCACGCGACGCGTTCG
AGACGATCACGAGCGACGTGCCCAGGATGACGAGCGCCGAGCCGCCGATCGTAAAGTACCCAGGCACGACGTCCACGCCCGCGGCGACACCGAGCATGGC
CGCCAGGATCGGCTCCATGAGCATCACGGCGGACACGACGATCGGGCCAAAGTACTTCATCACGCTCAGGTACCCGATCGTGCCCACGAGCGTGCACACC
ACGACGATGTATAGCTCCGTGGCGATGCGCGTGGAGCGCACCCAGCCAAAGAGCCCGATCGTGTCGTGCGTCGAGAACTGGAACGGCACTTCCAGCACTG
AGAACACGGGGAAGTGCAGCAAGCTCGAGACCAGGAACACGCCCGTGA