Description :
From Genome Similarity Track
Location :
Scaffold_4:247136- 256730
Transcript NameFunction/comments
Phyke_g466conserved hypothetical protein
Phyke_g467hypothetical protein
Phyke_g468conserved hypothetical protein
Phyke_g469hypothetical protein PHYSODRAFT_309493

Sequence
9594 bases(100 bases per row)
GCTTTACGCTGACCCGAAGACGCAACTTGATGCCAAAGGAGCCGAAGCCCTGCATCTGTGGAGTCAGCCGTCCAAGCGTGTGGCGACAGTGCCTCGCCTC
GTTTTCTCCATCACTTCGGCGCGCGAATCTGCGGAGAAGCCTGTCGAGTACAATTTCGAGTCACAGGCTCTGCAGAATTAGGTGCTTCCTGCAACTTACA
ACTTGTTCCATGTGACTTCGCACATGATGGAGATTCGTCTTCAGATCGGGAATGCCAATTTTTTGTCGTACCGCTCGATCTATTTTCACCCAATCTTGTC
GCTTCATTTCTCATTCTAGCCAATCAGAACGGACCCAAGTGTTACCTACGATCgcattttggagctgctcgactCGCGGCCACCACTAGCACTTGCCTGG
GTGTTCTGTAAATATTTCTCGACGTCGCGTGAATAATGGAGCGGTaccagaagctggagaaggtcgGCGAAGGCACGTACGGCGTCGTGTACAAGGCCAA
GGACCGCGTGACGGGCGAGGTGATCGCCCTGAAGAAGATTCGCCTGGAAGCCGAGGACGAGGGCATCCCCAGCACGGCCATCCGTGAGATttcgctgctg
aaggagctgcagcactgcaacaTTGTGCGTCTGTACAATATTGTGCACACGGAGAGGAAGCTCACCCTCGTGTTCGAATACTTGGACCAAGATTTGAAGA
AGTACTTGGATGTCTGCGAGAAAGGGCTGGAGAAACCCATCCTCAAGTCCTTCCTGTACCAGTTACTTCGGGGCATTGCCTACTGCCACCAGCATCGTGT
GCTGCATCGGTGTGTGCCTTGTTCGTCTTTCAGTTGGATGAGAATATGGTGATAACTGATACGTGTGTTTTGCCTCGGAATCAGTGATTTGAAGCCCCAG
AACTTGCTGATCAATCGCGAAGGCGAGCTGAAACTTGGTGATTTTGGGCTGGCGCGTGCTTTTGGTATCCCAGTGCGAAGCTACACGCATGAGGTCGTGA
CGCTTTGGTATCGCGCACCTGACGTACTCATGGGCTCCCGGTACGCATTTGTATTCCTACTTGTTCGTTCAGTTTTATGACGTTGTTGCTAACTTCGTGT
TTCATCGCTAGGAAATACTCTACACCTGTGGACATTTGGAGTGTCGGATGCATCTTCGCCGAGATGGCGAACGGCGGTCCGCTGTTTGCCGGCACGTCGG
AGACCGATCAGCTCGATCGCATCTTCCGTCTTTTGGGCACACCCACTGCCGAGATATACCCAGCCATTGTGGACCTCCCAGACTACCGAGtacttttttt
tatttaCCCCGCGCCCTGGATAGCATATCATTTCTAACGCCGGTGCTTTGTGAATGATTCTGCTTGTAGCGAGACTTCCCCGTGTACGAAACGCCGGAAA
GCTTGGAGCACCTAGTTCCAACTCTGGATGCAGACGGTGTGGATTTGCTAgagcaaatgctgcaatACGACCCAGCAAAGCGTATTACTGCTGCCGACGC
TATGCTTCACCCGTATTTCAGCGACCTGTCGCCAGCGCTTACTGAAAATCAATGAGGCGTCGGCTATCAACGATAAGGACGAAGCGTACGAGGTACGAGG
GTACAGATGGAAGGTAGCATCATCCTGAAGAATGAGTGGCGTGGGTTGTTCCATGCAGTAGCTTTACCTGTATTGCTGTCCGTCCATAGAGAGACAATGC
AGCTCTTGGAGAATCGATGGAGAGCAACAACTGGAGATATGTCAAGGTAGAAGAGCCGTTGGTAAAAGTGATAAATACAACATCGTGTCTTGATGAATGG
CAGCGCGATATTTCTGGAGATTATCAAAAGCCGCCAGGCTAACCACCGTGGGTTTGCCAGAATGGTGGAGCACGCTCTCCAACATAAGCGAGTTCGTGtt
gtgcttgctcttcttcttttaCTGTATTATCTGCAAGCCGTAGCAGCGACAAACAAGGAGAATTCCCGAGCCAAGTGCATTCGGAGCGTGCCACGATCAT
TCACACAGATTCAACAAGAGGAATTGTGCGCCCCGGGATACTCAGCTAGCAGCATTCAGAGAGATCCGACGCCACCTGGTCAATGTGCCAAATTGGCGTT
GGGTGGTCGACCTTTGCAATCCACAAAAGTTGCTTCGCGAGTCGAGTTGCTTCGTGCTGCCTCTATCATCAAACTTTGTGCTGGGGCACGGCATACTGGT
CCAGCAAAGTGCTGGTTAGCGATCCCTCCTCAAGTTCGGCAGCAGATACTTGTAGGTTCCTCGTCAACACAACTGGAGGCAGGCTTGTTGCCATTAGTGC
AAATTTGTCGACACGCCCACAATGATGCCCCGGCGAAGTGCTTTTTGCTCTGGCTCAAGATGAGTAGCTCCAAGAACAAACAAGATGTCCAGGATATGCT
CATGGCTGCTACAACTCTGTGTAAAAACTTTGACGGTCAGGTAACCGCTCTGGAAAAGTGTGTGAAGCAGACCACACCTTACTtgagaactgctgcaaag
ACGGACATTGAGGTCCTCAAGCTCTGTCAGTTCAGCGGAAGTGGGGTAAATTTACCATCCATCGTAGAATGCGCATCTGAGCTGGGCAAGAAACACGTGC
CACCTAGTATAATTGTTGAACTATGCTCGAGAACTTaccgtagcagcagcactcggCCTCAAGAATGTTTTCTGGAAGCACAACGCAAACTTCGTTGGAT
GGGCCTAGATGCCCAGGTCGCTTTATGCAAGGATGCGGTTTCACAGTCTGCCATCGCCCCAGTTGACTGTGCtgtcgagatgaagaaccaTGCGCGAACA
TTGATCTCTTCAACCTCATCGTTTTCTTCCGGATCAGCAATAAACATGTTCGTAGCCAATGTGTGTTATCGTGCTaccaacgccagcaatgTTGTTGAGT
GCATTCGACTTCTTCCCGTAAGTGCTTTTACACCGAATCAAGCGCTTCGACTTTGTGCGGCCTCCACAATGCCTTCACACTACCCTAaggatgaagacaa
cgaATCTGTCGCTCCCTTCTATCGGACGAGCTGTGCTTCTCGAGCACGATTACTTCTTCAACGATCCATCGCATTAGACGCCAACACTGCGCAGGAAATA
TCGGCctccgctgcagctgttcGCGTATGTGAATATGCGAAGTCAAGCGCACCAAGTAAATGTCTCGCAGATACGCAGTTCGACCGAGCACTTTCAGTAA
GGCTGCGGATCCAGTTGTGCCAACAAGCAATATCCGATGCACCGCAACGATGTTTGAAGTCTCTCCGCAAATATGTCAACGCTGGGCGTCTTGGAATTTC
TGATGCTGTCGCCGCGTGCCAGAACACAAAATCGCTAGGTCCAGCCGAATGTCTGATTGAGTTACTGCGAGCTCCAGTCTTGGTGAAGTCAAAAACTTCC
GCACAGCTTTGTCAAACGGCAGAAGATTTAGAGCCTGCCCGTTGCTTTCTCGCCTCCCCACGTTCATATGACGACACGATAAAGGTTGAGCTATGCCACC
GAGCCGAGAGCACAGCCCCAGCTTTGTGTGCGGCAACAGTTATCACCCGGCTCGGAAAAGATCTATCCCAGAAGGCTGCCTTGTGTCGGGGCGCAACCTC
ACAGGCACCTGCGACTTGTGCCATCGAGGCTCCATTTGGCATCGATACAGAGAGCCTAGTTGAGCTTTGCCAACATGCTGTAAGTGCCGCACCTGCGAAA
TGTGCTCATACTGTGCCACCGTCGCTTGGTATTCCCTGGCAAAAGGTGGCGCAGGTATGCACTGGTGCCACGACGACGATCCCAGGGCGCTGTTTTGTTC
ATCATATCCGCCATTCACGCCTGCATTTCCGTATTTTAGATGACAACCAAGTGGTCACTGAATGCCGGCTAACGATTGCACGACCTTCATCCTTGGAAAT
TGCGAAGGCGTCATATAACTGTCCAGAGCTACGCCCAATGTGCCCCTTGCAGATTGTGATTAACGTGTTGGATCAATACGGCGATGCCATGTTGGAGAAT
TACCGCCATCAGTATCGTAGTGGAGACACCGTGCATGTAATCACTGTATTCAACAACCACGGTAGTCGACAGCATGACCGTACAGGTATTCGACGCCAGA
TACCAAGTCTGCAAGGTCCGTCCTACGCCATGGTGGTCAATGGCTCCGCTGTGTTCACAAACTTGCTCTTCACCGCGGCAGGCGAATTCGTCCTAACCTT
TAATGCTGGGGAAGGCATCACTGAAGAAGTTGCACGCGTCCTAGTCCATCCCGACCATGTTGCTGAGGCTCTTGAAATGCGTTGCGACGCATTATTCACT
CGCTTTCAGTGCAGCTCAAGACTCTTCTCGTCCACTTCACGTGACCGCCTACACCATGAGTTGCAGATGCTGATCCTTCCACGCTCTCTCCACCTCAACG
CGCTCTCCTGTAAGCAATACTGGCTGGACAGCATTGGCGGCCTCGTCTTCCGTGGCTTCTCTCCACTCGGCGACGTGTTGTATACGCTGCCACGTTCGCT
CTACGACCTGTTCACGTGCGTAGAGCCTCGTAACCACCCTCTCTCTTTCTTGACTACCCCTGATCTGACTATGTATATGTATTTGTATCTATTCAATACA
GAAGTACGAACGTTCCGCATGCGGGTATGAGTGCATGGGCTCTCCTCGATCTGCGCGAGGGCGAGGCGAGTCGCGCCGCCATCCGCCGCGCCTACCACCG
CAAGTCGTTGGAGTGGCACCCGGACAAATGGCATACACTGCTAGTAGCGCTGCCTCTCATctggcagcaggagctggttGACATCTACGCGCTCATGACG
AGTGCTTACGACCAGCTTGTGCGCCACAAGTTGAACTGACAATCACTCTTGCTGTATTGAACTTCAATACACGATTGAACGACAGTCACGTATTATAACC
AATCAGCTTTCTTATGAAGAGCCAATCAGAGCACATCGATACTGGTACTGTTAGACGAGAATCAGCCCAGCATGCAAGAGGCGCTGCTGGCGATTCTGCG
CGGCATCCGCAATGGATCGTACTACGGCACCAAAGTGCGCGCCCCGCACGGTACGTTACTATAGTGATCTAGCTCATTGGTGTTTATTTCGTGTGGGTCA
CGTCTTGATTTGactactgctgcagccatggTGATGATCTTCCTGTTCCAGAAGGGATCGCTGCGTCAGAAGCTCCGGGGTATAGTGCGACTTACATTCG
AGCATAGCAAGAACCTGGCGCTCTTCGTGGGAATATACAAGActgtgctactgctgttACGGACTCATCAGCAGCGCGGATTGGGGCAGCACGTGACCGC
GTCTCTTGGGAGACCTGGAGCACACTGGCATGCTGCCGTGGCAGGCGGCATCGGCGGCTACCTTGTGGGGGGATGTTACTCCAGCGTGAACTTCCAGATT
ATCATGTATCTCATGTCTCGCGTGCTTATCAGCTCAGTGCGGGTATTGGCTGCCAAGGGCTACAAGCCGTTCGCGGGGCACCACTTCAAGCACGTGTAtc
cgctgctgtcgtcggttGTGTGGGCGAGCGTCATGTGGCTGTACGAGAACGAACCAGCCTCACTGCAACCGTCGCTACATAAGAGCATGACATTCCTCTA
CGACGAGTCGTGCAGCTGGAAAAACGGCCTCGTGGACTTCCTCCCTTCTCCTGCCACGACCGCTGTCATCTTGCTCGCGTGGATGCGACTTTAAAATGAG
TGCAGCTGCTATAGTGAGACGAGGTAACTCGCAGCACCGTCACATCCTGCGAATTTACTCACGATAATATTTTGTACGTTGCCGGTTTCAACGTATTTTG
CAACACTGTATCGCATGCTGATGTTGATTGACGGCGTTCGTGTCTGGCACGTCGACAGCACCGTGTAATAACAGCGATTTGTGACGACCGGGCAAACAGC
GCCGAACAATGTTCGGCGCACATATCATGTGCGCGAATTAACAATAACAGGACTTGAGTTTTGCCCTACTTTGTTCGTGCTGAAGTTGGTCCACCCGTAG
CGAACCAGCCAGGCGGCTTGGCGGAAAAGTACGTGGCACCGCGTTTCTTCCCGcgttgtcatcatcgtcggtATCGCGTCTCACTGACGAGTGCACCATC
AATAATGGCATTAGTGTCTCTGTGACACATTTTACGTTTAAGTAGTTATAACGGTGATGGAGCCTATTCCGACCAGGTGCAGTGTGGTGCTATAACATGT
GCTACGTGGTCGGTTATTAAACAATACGCGAAAGAGACTGCAAGTTGAGACAGTTTTGTGGTCAAGCTGCCCAGTAAATGAGGTATGTGTGTAGAGTGGA
TACTGTTTACCTCAAAGGATGTGGACAGATTTGTCACCACAGTGCGAAGACGACCCAACCGCCAATTGACAAAGTTGCTCGTGCCTGTAGCGATCTCCGC
TGAGCCTGCGTCCCGTAACTCGTTCATTCTTGTGTGTTTCGTTGTGAACACAAACAACAAATGCACGTGCCGACCGCACTAGTTGAGTAGCAGATCCAGT
TGTAATAGCTTAGCGTTCAGTCTTGAAACGCTTCAACTTTGCGTGCAGTGAGAGATTGATGAGTAGCGCTGGCGTAAATGGAGTTACAGGGATTTGACGT
GCCGTATCTCTTCTGGGCACCGAACCTTGCACATCTAAAATATCTTCGGATTTTTATTCCACGAGTGCAGTCTTAAAGTTAAAACTCGCTCCGCACGCCC
TTAGGTGTCATTTCCATCCACCGATTGAGAAGTGAATGAATGCCATAATCGTGAAGGCACCTGTCTGCAGCAGTAAAAATAAGTCGGGGGGGCGTTCACA
CTGGACCAAGGGCAGAAGGCACGTGGCTCTATCCTTCCGAGTAAATGCTCTTCaatgcaaaaaaaaaaagaagacgGGAGAAGACGGGCACGAAGGAGAC
ATAAAGGCCATCGTATCCAtccacaacaacatgaaCGAACGTGTATGGGCTCAGACGAAAAAGTGTGTTACCCAGACCTAAGCATTCTTTCTTGTTACGA
TACGAATTCAACCCCCAAAACTTGCTTTTAGCCTAGCAAAAGCCTTCTGTTTGAGTGCCTTATCACCTCATTTAAGACCCGCacaaagagcagcagcaga
tgaagcggTGAGGTTCTGCGACGTCAACCGAACGCTTCCCTCTGTCTGCGCCGATAAAAGACCAAGCGGCAGTGCCGCCCAGTCGGCATATCGCAAGAAC
GCAGGTGAGTGAGAGAACGAGCCTTTGTCCAGATTTAACGAATTctcgttggtggtggtcgttcATGGCGAGAGAGGGGGGACGCATTTATTCTACGTTT
CGCTTGTGAGAACAACCCGCGACACGCGAACGGTTAAAAGGCACCATCGAAATCGGCCTCGAAGCacaaccaagcagcagcagaaacgaATTAGCAAAGg
aggaaaaagaagaaggagcacAGATACAGCAATGGGAAACATCATAAGCACAGCCAGTGCCAACATCAGCGACCCCAATACATCATCTCAACAGTTAGCG
ACGTCAcccgtgaagaagagcaaggaTAAACCCCACTCACTCTCAGACTCGACCGTGACTTCTTCTCAGGACAGTGAAAATGGGGTCGAAGCCATGATCC
AGCGAGTAGGACGGCGTAGAAGGCGCGAGAGCTCTGAGAGCACAGCTAGTAGTCACAATAGCCACAGCTCGACTTTGGACAAGACTGGCATTCGTGGTGT
AGAAGACACCCATACAATGAATACGACAGGCTCCACGACCAGATCAGGCAACAAGGCAATGTCGCTCGTGAGTGGTATGCTCTCCTGGCTCATGTCGTGC
ACTGGTGGCACCGGATCGGATCCTGCTgagcagctggaggacgGATATGACTTACGCTACTTGGTCGAACAGAGGCATCGCGCGTTCTGGGAGCTGGTTC
AACGTATCTTGGAGCTTAATGACGTGGTTCTTATGATCCGGATGTTGCTAGACTTCCTGCAGGACGATCTAGGTGCATCAGTAGCGGCGGTGTTCTTGGT
GGACCAGAATTCGCAGAGTATGTCTCGTATCATGCGAGGTACACCGACAGAGTCTGGATTGGTCCCGTCGCGGGGATTGGTGGGCGAGGCATTGAGGTCA
CGTGTGGCGCGGTTTTTGGTGAACTTTAACTTAGACGAAGGCTATGATGCTGAGGTGGACTTGGCGCAGGAGTTTCAAGGTCAAAAACTGTTTTGTGTGC
CGTTGATAGAGCACGATGCTGTGTATGCAATTATTCAAGCGACAACAGCCAAGCCCACGCGTCGAGTAATGGACGAACTCCATGTGAAGTTGCTGACGTG
GCTTGGACCGATCTTGAGTTCTTGTATGCGTAAATGCATCGAGTTTCATGATGTACTCCTCTCGGAGCGCACCCAGAAGGCTTTGCTGCATATCATTAGC
TCTTCGGATACAGAGGACACAGTACTGAACCTTGTGGACGGTGTGATCGATGGCGCTTGCCATATCACGAAGGCTGGACGTGTGTCGCTTTTCATGGTGG
ACTGGGAAACGGAAGAACTCTGGTCTCTCTCGTCTAGTGACTACGACGAGACACTTCGCGTTCCTCTTCGAGCGAGCATGTTGGGCCTTGCAGCGACAAC
GCAGCATACGCTTAATGTTCGTAACCCACACACAGATCATCGTTACAACTGGATGACGGACCAGCGCCGCGGTATTGACACGGAATGTGTACTCTACGTA
CCTGTGGGCGTCCAAGAGTCCTCTCAAATCAGCGAAGTGGCCAGTACCGGTAGTAGTCGACCAGTTGCCGTTCTGGAGATTatcaacaagatggaggcgG
AAGTACCAGGTGGAATGACTGGAAGTAGTTGCTGCGGAGGTTTTACGTTCGATGATGAGTGTGCATTTGAGGCGTTTGCGTGTGAAGTCGCAGTCATTTT
ACGTCGACGCGGCAACGAGATCGAGTATATTAAGCTGCTGGCAGACACGCGCGCAGAGCAAGTTCTAGCAAAACGTGCTCGGAGTCAAGTGAACCTGCTA
GAATGCTACACAAGCTACGCTTCAACAGTTCGCGCTGCACACCCAGAAGCTTGTCTTCGAAATTCGTTTGTTTCGAGTGACAAGCACGTTGCAGATTGCC
CTGAATGCGCAGCTGTTGCCAAGAATGAAGCCTTGGTCGAAAGAATTGCTCCTGTGGAGCAAGAGGTTACGCTGGTATGTGGTGTTGATCATGCGCGTGC
CTTGGTTGATGTTGAGCGTCTCAGCCGGACAGTTGGCGGTGCAAAGCACCAGTCGGGCCGTTTGGGTTACGAATTCGTGAGCAGTGAGGCAGAAATTCTA
TCCAGGTTGGTGTTTAGTGCACCTCCAGGATCACGTTTCGCGTCATGGGACTTTAACGTGTTTACTGCCGACCTAGTAACACTGCCTAAGCTATTGGAAG
AGATGTATTTGGATTTCAAGGTGGATGAGGTGTTGCACACGACAAAGCACCGCCTACAAAACTTTATTGTCGCGATGAAGGAGCACTACCATCCGAACCC
GTTCCACAACTTTTTGCATGCTTTCTCAGTGGTCCATGCGTCGTACCTCTTGTTGAGCACGACTGATGCGGCGCAAATGTTGCAACCACTGGAC