Description :
From Genome Similarity Track
Location :
Scaffold_46:247034- 251725
Transcript NameFunction/comments
Hyaar_Emoy2806141pyruvate dehydrogenase E1 component subunit alpha
Hyaar_Emoy2806142hypothetical protein

Sequence
4691 bases(100 bases per row)
AAATGATGATGCTCCGCCGCTCGACTGCTGCGCTGGTGCAGAACGCCGTGCCTGTCACGCGTGCGTTCAGTGCTGCTGCGAACGCCTCAGGCGACGTCAA
GTTTGATCTCTCAGATCCCTATGTGCTGCACCGTAAACAACCGCTTAATCTATTCGCATTCAGTTAAATTAATTTATAAATAACCTCATGTGGTGTATTG
TATTTTCGTTTCTATTCTATTTCTAAATACAGGTCTCGATGAAGGACCAGCTGAAGTAGCAGTAACGAACCGTGAGGAAATGTTGGGCTATTACCAGATG
ATGTACACGATGCGACGCATGGAGATCACGAACGACAATGAGTACAAGGCACGGAACATTCGTGGATTCTGTCACTTGTACGACGGCCAAGAGGCCGTGG
CTACAGGTGTTGAAGCTGCCCTGGACCGCTCGGACTCGTGGATCACTTCGTACCGTAATCACTGCATCATGCTCGCTCGGGGTGCTGAGGTCAAGGACGT
CTTGGCGGAGCTCTTTGGCAAGAAGGACGGCGCCACTGGCGGCAAAGGTGGCTCGATGCACTTTTACAACAAGAAGAACAACTTCTACGGTGGACAGGGA
ATCGTTGGTGCTCAGGTGCCGGTGGGAGCAGGTCTGGCCTTTGCTAGCAAGTACAACCACGATGGCGAGGGCCTGATGCCTTGCGCCATTACGATGTTTG
GTGATGGTGCCGCCAATCAAGGTCAAGTGTTTGAAGCTTCCAACATGGCTGCTCTCTGGAAACTGCCGGCTATCTTTTGCATTGAGAACAACCAGTACGG
TATGGGCACGTCTACGCAGCGTTCGTCCAATAACACGGACTATTACACCTATGGCAACAAGATCCCTGGCATCAAGTGCGATGGCAATGACGTGCTTGCT
GTCCGTGAGTGCACAAAGTTTCTCAAGACGTGGTGCGGCGAGGGCAAGGGCCCTATCTTTGTCGAGATGAACACGTACCGCTACCACGGCCACTCCATGT
CGGACCCTGGCGTGACGTACCGCAACCGTGACGAGATCTCGCAGATGCGTGCGTCGCGTGATCCCATTGAGCTGGTGAAGAAACGCATGATCGAGGCTGA
ACTTGCTACGGCGGATGAAATCAAGGAACTCGAGAAGAAGGTGCGCGCTGAGGTCGTAAAGGCCACCAAGGAGGCCAAGGCCTCCGCCAAGCCCGATGAG
GCTTCGGCATTCGTGGGCGTTTACGCGGACGAACAGGGCAAGAACGAGTACCCGCCGTTCATTCGTTTTCCCGACTACACGAAGAGTTTATACAATGGCA
AGCGTCAGTAGGTGATGACTGTAACAAGGAGGGCATGTAGCAACGGGAGACATGCTACTGTCAACAAGAGGGAAGAAAATAAGTAGCCAAGCTGCACTGC
GTCGTCATGTGCTCCAAAAGTGCTCGCTTTGGAGCACGTCGCTGTAGGGTGCATTAGAATCCGGCTGGTGATGCAGAAACTCTTAAGAATAGGCTCGTAA
GCTTTTGTAATCCCAGCTGGATATTTGGAAATGCTCAGGGCGGTCACATCTGTTTGGCCACCGCCTTCGGTGATAGCCTTTTGACCGTTGTACATTGGTG
GACGTTGTCACTTTAAGCCACGTTACGTCCCCCGATGCCGTTCAAAAATAGGCGAACGGTCATGTGATCTCATGCATGCAAGACCAAAAGCTCCTAGCCC
CTAAATATCGTTATTCGCTTCGTTACCGGTGGCGTCCTTGGCACGTTCTGTGCGCCGTGCCACCTAGAGTATGTCCCTGTGGGATTCTTGTTGCAGGTCG
CAGCCACTGCAGTTGTGTACATGATGCAACCACGTCCAGAACTTAATATTGACAACACTGCTGCATTGCTTGACAATGTGGTCGAGCCTTGGAATCCACT
TCGTCCTTCTCCGAAGCCGAAGTGTTACGAAAAGCTCATTAAGGTCAATTTGGCGTGTTGTTAATCGCACAGAACATCGGCTTCGGCGCAACCGAAACGC
TGATGAACAGGCACTAGCACTAGACCATTATTGGTAACACATTCTCAATTGCGGTCGCGCTGTTTTCACTAAACCCGAACCATTCGACGCATTATCGATC
GATTAGCTCTTTTAACTCTACAAACAATAAATAACGTGCTCAATTCCCATGTTGAAGCTACTGCTACTATCCACGTGAGAACAAGACCCCTGCATCTCCA
CCGCTTATACTTCTCGTCCTCATAAAGTACTCACTCACATTTGCACCCGTACAACTGCGCACATATTTACGCACTTCACTGATTTACCTGCTTCCGGCCG
CAACCTGCGTGTTCATCGTCGATGTCTTCGTCCATCGCACCATCGTCATAATTTACCAAACGGCTGGAGCACATCACATCTCAGCGCGCGTACAGCACTG
CTCCAGAGCCTGAAGACGTATCAGAGCTGCTGGTCTGGGAATAATTACGAGATCGCGGACGCGCGTCTGGACCAGTACTGCTGGCAGCATCACTATTGTT
GCGAAGCATGGGTGCCATGAACTCGTGCTCCTGCTGCAACGCTAAGATGCGATGGTGCGACAGCTTTCGTGCCTGTTGCGCCAAGTTGTTGGCGGCAGAG
ATGATGTTCTTGGCTCGGCCCGACGCTCCGTTCATCTCGAGCTTGTCCTCATCACTTGTTCGAGCCTCTTGGCTACTCCCCTGACTACTGTGACTGCCTG
AACAGCCTGTACGGAGACTCTTGCTGCTCTTCGAAGACGTACGGTCGTACGTCGACGTTAATCTCATGGTCGAGTGCGTGGGCGATACGGACGACGACGA
CGTCGTGGACTCGTCGTCCGTATTGTCGTGTTCGTCCAATCCGTCCCCGCCATGACGAGGGGCATTGCCCATGCGCTTCTGGTACAAGCGAAAAGCTTTG
ATTGAGATTGCCAAGTCTGCTGGGCTGCCTCGACGCTTGGCTGCAAACAGCGCCTTGTTCCGCATCCCAAGGCCGTCACTGAAGGAACGGACCGGGAAGC
TGGTCTTGGGAACGCCAACGGATACGGAGCCGTCTTCACTACCCGACGAGAACGTCTTATACTCAATGAGTCGAGAGCGCACAGGGTCGAGAAGGGTGTC
ACACGACCGGCGTCCAGACACTTCCTCATCTGTTGCAGTTGAAAAGCTCTGCGCACGAGCCATCCTGCGTGAGTTCACTTTCGAGCCGGCAGACAACTGA
CTGGAGCAGTTCTTGCTGAGTGGAGAAGGAGGTAGTTCCATCCCACTCACTGCGTTGCGTGACAAGCGACGAGCTTCAATAACACACACTGTGCAGACCC
GCAGCTGGCGCTTGCCAATGTCCGGCACCTGAACACAACGCACAGCACTGCACGAGCTGCAACAGACTTCGCCACACTTGAGGCAATTGTAGCGACGACG
ACGAAGGCAAAACTTCTTCGAGCACGTGCGACAGTGATCGCACTCGCTCATCGGCACCACTTGCTGCGGGAGCACAATCTCCTCTCGACCGACACGAAAG
TTTTCCGTGTACTTGGAGATCCCGTGGATGCACTTTTCCACGTGCGACTGAATCGCGGAGCTGGCAATCCACGCAGGGACGTCCCCGTCCTTGTTGAAAG
TGCACGTGTACGTCATGCGGAGCTCCCCCGACCTCGTGGTCGAGTGGTACATGAACCCCATGAGTGGCACAAGCTCGCGCGTGCGCTTCGCTGACTCGGC
ATACTTGGATAAGCCTGGTGGTGTATCCACCGACTCCATGACACGAAAGGCCGTCAACTGTCCCTGAGCATCTTCAATCATATCGACGTACTCAAGCATG
AGCAAGTCACGGTCCTTGCCAAAAGGACTCGAGCTCTTGAAGACCGCCCACTTGAGCCCAACGTAGCGATGCGGGTTCGTCACTGAAGGCTCGACAATGT
TCTGCACAACAGCTCCATCGAGGAAATCCGAGGACAATGTAGCCATCATCCGTTTAAAGGATGTTGTCGTGGGCGTAATCAGGGACGCGGCCACGTCTTC
AATGTCACAGGCAAATTTGCACACCGCGTGGACATTGCACGGTAAGCTGCTACTACTGCTAGTGCTGCTGGTGGTGGTAGTTGTTTTACTACTGGACCCT
GCACTGGTGTCTTCGTATGCCTGGAAAAGCGAAATCCCGTGCTTGTCGCGCACCCGAGTCCAGGAAATGCCACCGAGGAGGTCCGTCGCTTCCAGTAGAT
TTTCCGTCATGCGCTTGGCCATCGTCGTGAGCCGGGCCCGCTCCTTTACAGACAAGACACACGTCTCGTCACTAGCATCAACCTCGTTGCTGTCATCGGT
CGCGTCCGAGCCGTTTACCCACGAGCCAAAACTCGTGACTGAACGAGGAGTGAACGAAGTGGCAGCAACTTCGACCGATGGAATACCCGAGTGGGTCATG
AAGAGCCGCGGACAATCGGATGAGGAAAAGAAAAAGCGGGGGCGAAGGCGACACGTTGTTTTGTTTCGAGAGACACGCGCCGTAATGTGCGCACAACAGG
TGAAAAGCGAAACTGAGCGATCTATTTGAAGCTGCGAGGAGAAGTGAGAGTTCGGCGTTCTCGTCGCACGTACCGTTTCGTGTCCGGGCTGAACTCTATT
TTTAAACAACACCGGCTGGTAAACGGCTGAGCTTGACACTTGTAGCTGCTGACTAGTGTTAGTTTTCTTCGATTTTCGTCCTGACGTACCC