Description :
From Genome Similarity Track
Location :
Scaffold_1637:2470- 6242
Transcript NameFunction/comments
Phyta_totarag13398hypothetical protein

Sequence
3772 bases(100 bases per row)
ATTCCATATCGGGCAGTGTGATCTACAGTGCCATCGACTTGACCGATGGCTGCTATCAGATCCTGATGAGAGAGGGCGACGTTCCACTCACGGCAGTGTG
CACCCCGAGTGGCATGCTCTGAGAGTGGCTGGTGATGCCACAGGGTCTGAATAATGCACCTGCCACGTTCAATCGCATGGTCTCCCATGTGCTATGCCCT
CTCCAAGACTTCGCTTCTAGTTACTTCGATGACATCTTCGTACACAGTCGCGCTGAGTGTGTCCTCAGCGCAGTCGATGTTCATTTACGACACTTGCGGC
AAGACTTCCAAGTGATACGAGAGAATAAACTCTGCgcaaagctgaagaagtgcgtGTTCTGCGCGCCGGAGATTCCAGTGCTTGGTTGATACGTGAGCAA
GGATTGAGTCCGTGCTGATCCCGAGAAGGTACCGTCTATTTGCGCGTGGCCAGTTTCACGGAACCCTACCAAACTGCGTCAGTGGTTGGGCATGTCGGAC
AATCTTCACAAGTACACGAAGAATTACGCTGGGTTGATCTagccgctgccgtcgctgttgaagAAAGACGccacgtggacgtggcgtCCGGAACACCAAG
GGGCATTCGACTCGGTGAAGAAGAGCCTGGCGTCCGCGCCGATCTTGATGCTCCCAGACGACTCGAAACCATTTCACGTCGTCTGCGACGCCAATGactt
cgccagcagctgcgcacTAATGCAGTTTGATGAAGAGGGTCAAAGAACGTGTCATGACTTGCCACTCACGACAGATGAAGTCGGCGGAACGAAATTATCC
AGTACACGACAAGGAACTCCTTGCAATGTGCTACGCTCTGATCAAGTTCAGAGTGTACCTCCTCAGTGAGCAGACCTTCGCAGTGTACATCGATCAGGCA
TCGCTGCGTACAACGATGAAGAGTCCTCACTTGTCGCAGCGTATGGAACGATGGTTGTCGTTCTTCTCCGAATGCAATTTCGTGGTGCACTACAAGCCTg
gcaagaacaacattcTCGCCGACGCATTGTCTCGGCGTCTCGACTACGATCCTCGCGTGGTATTTGGGTCGTCAGGTGACTaacgatgaggacgacgaag
acatcTGTACCACATGTTTGGCGTCAGGACTCGATCTGATGATCGTCGAGCCGGTGATGCCGCTTCGCGCGGAGATTAGCGTCGCgtacgagagcgacga
cgtgtACGCCAGTATCCTGGCTCATTTTCGCTCTCCCAGTGACAAGACACTGGAAGCCCTGCCTCGTACCACGCGCAGTCACATCGCCCGCTATCAGCTG
GATGGCGGGCTGCTGGCCTACAGCATCGATTGCTTCGATGCCCCTCGAGTGTGGTGCCAAATGACGTTGACTTGCGCGCGCGAATCATTCACGAGTTCCA
CGATGCCCCAGTCAGTGGGCACTTGGGCCGCGAAAAGACTTTCGTTGCAGTGTCGAGAGACTTCTACTAGCCCCATATGTACAAGCGGGCGCGCAAATGG
GTGCGCACTTGTGAGATCTGTCAACGGATGAAgccatctccgtcgtcacaAGCTCCTCTGCGTCCTCTTCCAGTGGCCACCGAGGTTTGGCGCTCGGTGT
CGATGGACTTCATCTTCGGGCTCCCACCCAATGCACAGAGCCACTCGGGTGCTCTGGACTTCCTCGACAGGTTCAGCAAGATGATCCATCTCATTCCGGT
GTCGGACTCAATCACCGCGGATGAGACCGCGGTGCACTTCGTCGACACCGTGTTCAGACACCACTGCCTGCCCGAGTCGATCGTTTCCGACCGTGACCCG
CGATTCACGTCGGTTTTCTGGTCGAAGCTCTTCGATCTCCTGGGCACGAAGTTGTTGATGTCCACGGCTGCGCATCCGGAGACGGATGGCCAAACAGAGC
GAGTCAACAGAGTCCTCGAAGATGTTCTTCAAAGTTACGCGACCTCGttcgcgagctggagctcgctCCTGCCTCTCACCGAGTTTACACTCAACAACGC
TGAGCACACCTCTACCGGACTGACAcccttcttcgtcaacaacGCGCGTCACCCGCGCGTTCTAGCTCTTCTCGCTGTGGCCCATTCCACGACGCCTATG
GCTTCACTCTGGGTGGGGAAGGAAGTGTGACTGCTGACGTCGACACCTCGGTGAAGGCACCGGTGTTGAACTCCCCACCGGTTTCATCACCGGTCGATAA
TGggtcagcagcgtcatcaTCCATACTACTTCCGAGTGTATGCGACGGTGTCGAGACTGCCAACGATGTCACGCGCTCCAAGAAGACCTTCGCGACGCCA
CAAGTAGCGGCATCTCCGTTCGCCCAATGGACGACGCGAACTCTGATCGACCCCGCCACTCTGAAGGTGCCCCACAACGCGAAGGCTGTAGTGGCGGCCA
ACTACGCGCCAATTGCTTCGGCGCTCCCGATCGATAGTGCGGCTGTGTCCTTCAACGCCAATCGTCGCCCGATTCGTACGCGATGCCATTCAGCTGGCAG
TCGATAAGCAGAAAGAGAACGCCGATAAGCATGGAAGGAAGAACATGGATTCATTCACGATAGGAGATCGTGTGCTACTGTCGACAGATGGATTACGCGC
TTCTGCGGTGACGAACCTCGGTGCGAGCAAACTCGCACCGCGCTTTATTAGGCCTTTTAAGGTGACGAAGCAAAATTGGTGATGCCTACACACTGGACAT
ACCATCGTCACTCCGACTTCACCCGACGTTCTACGTCGAACGCTTGAAGAAATATCATCCAACTACGATTCCTGGTGTGGCTCAACAGGCCGAGCCAGCA
CAATGTAGATCGGCCGACCTTCTCGACGCCAACGTCGAGCAACCAGTCCATGAGTCGACTGGCGAAGTGGGTTCATCGTTCCAGCAGCCTTCGACGACCG
CTCCAAAACCccatcagcagcttgatgGGTATCCCAGTAGCGGTTCACGGCTCCAATCACGTCATCCTGGGCAACTAGGCCGCGAGCCATATCGTCACGA
CGGACCTCTTCCCATTGTTGACACCCCTGGTGATACTCGCTGGATCGTCGACCGAAttgtcgaacacgaagaTCCGCCCCGCCTGTTAAAACGTACTCGG
GCAGCTCCGGCCACGCGTCGTTATAGAGTGCGGTGGCTCGGGTTTCCACCTGAAGACGATCCTTGGGAGCCACGCGCAACCCTTCTCCGGGACGTCCCGG
ACGTGGTGCATGAGTACGAGGAGACACTCACGATGCACAGTGTGAGTAAATCGCCAGCGGCCGACTGCGGCGACAAAGACGACGATCCATCGCATCCGCG
CGATGGTGTTCGCCGTGAAGACTAAGATGTTATAGTGGTGACGACAGCCGGAATTAAACCGGCGACCTTCGGCATGGCACCCAGTGAGTAACCACTGAGC
TGTCTGGTGGCAACAAACTGAGTGAAAAAATTGAGTGAGTTTGCTATCACCGCGTCACTGGATATGTCAAGCACAGCAGGAAGTCGATGATACGCTTGTG
TCACGTCGCAAGCGCTGCTTGCCATTGGAAgtgttcgtggtgctggcgtcgaagccGCCCGCAGCATCACGCACTTCGTAGTCGACGTGATCGTGGGTTT
TCCCACGATGCGAATTGATTGAGCAAGACTCGTGAAGGCCCTCGCATCGTGTGCGTTCGTCACCTTGCCGTACCGCAGTCCACTGCGGGTTGTGAGGAAT
TCATTGATATCCACGATCGCCACGAAAATTTCGAACACCGCACTGGTCCGTGGAGGTGTTCCGCGTGAGGCT