Description :
From Genome Similarity Track
Location :
Scaffold_600:247- 7746
Sequence
7499 bases(100 bases per row)
TGGATCCTATGAAGGAATGGTGGTAGGTGCCATCCGAAGGTGGATCTATTAGCCACGGCTAACAAGAAGTCAGGATCCATTGCGAGGTACCCCGGATCCC
ATACTTCCGAGTTCGGATCCATGGAGGGAGGATCCCGCCTTGAGGGACCTGGATCCAGGGTATAGGGATGATGGATGCAGTGGATCTCGAACTTTCGTGG
GACAATGGAGATCACTGACGGTTGCAAGATGATGTTGGATGATTGGAGAGCTCGGATCCACGGCGAGTGTACAATTACAGTGAGGTGGATCCAAGCGACC
TGGATCCGGATGAGTGTACCCATAATAGGGTGACCATGATGATTACGTCATGGATCCGGTGGATCTGAAGATAACACAGCTGGGATGATGGGTCAAGGGA
AGAAGGGACATGCAGCCGAGCCTGGTAAGGGATTTAGCAGATGAAAGACATAGAAGGTAGAAATCCAGGCAGGTATAGGCTTAAATATCAATACAGACTC
CAATTTGCACAGTAACACGCAAGTGCCTTCCTGCCCTCAAGAACCGGAACTACATTGGCCGTACGAGCTCCGAGAAGGTTGGGAATTGCGAATCTAGTGT
TGGTAGTGATAACTGGATAATACATTGGCCAGATCCTACAACCTAGTGAGCTTTTCCTTTACTTGTGCAGATCCGACAGGTTAACCGAATTTACTACTTG
GTCGGTTACACCCTAGGGGCTCTCAACTTTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACGCAAAGGAACTACAAAGGCAAGGGAACACACCCGCAA
GGCAACCCTACGGCCAGATCCACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATACGGAACCATCCACGAACGCAGAGTGAAGATTTT
CCACTGCTGCTCCACCCCATCCCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAAAGAGCAAGATCCCGCCCTACA
GACGGGTACACAAGGTGAGGAAATATCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTGGC
AATCTCGCAGATTTTGCTGATCCCGCTACACCACACCTCGATCATGTTGGATGCGCCGTTCCGTGAAGCTGTGGGTGCTGTCATGCACTTGATGACGTCG
ACTCGCCCGGACATTGCTTTTGCTGTTGGATATTGAAGAAGGTGATGGTTGGATCTTGTGTCTTGCGAGGGGAGGACTGCCGAAGCTTGGGGCGAGGAGG
CCGAGGCGAGGGAAGTCACTTGAGGGGCAGAATGGAAATTCAGAAGTGATTGATTGATAAGAACTTACACTGTCTTCTCTACCTAGTTTGCATCCAATCA
TTTGGTGCATCCAATCACCAACACTCTGTACTCGTTTCATCATCCTACTCGTCTAATCATCGGTGGCGTAAACATCCTACCGTAATCATCGCGGGATCGT
ATTGGATTACCTGCAACAGCCCCTCTCAATGCGAACACGCTTGAACGCCAAGAGCCGTCGTTAAGTCCTTGTGACGAGGTCCGCCGAGTCCCTTGGTCAA
GATGTCAGCCAGCATGGTCGTAGTCTCGCAGTACTCGACGATCACTTCACCGCGCTTGACTTCATCACGGATGTGGTGGTACTTGATGTCGATGTGCTTG
GCGCGGCCATGGTTCACGGGTTTCTTCGTCATCTTGATGCACGACTGGTTATCTTCGAAAATCTTGAGATCCGGGGTGTCTTTGCCTGCAGCGTCGAGGA
TCTCACACAGAAGCTTGTGCACCCACTTGCCTTCTTGTATTGCCAGACTCAGTGCGATGTACTCGGCTTCACTCGTGGAGAGAGACACTTGACTGCTTCT
TGGATCCCCACGATACTGGTCCACCGAGAACTTGAAACAGGTAGCCCGAAGTCGACTTGCGGTCACTGTGGTCACCAGCCCAGTCTGCATCCGAATAGCC
ACGAAAGTCGATTCCGTTGCCTGGTGAAAAATGGAGTCCGTGCGACTTGGTACCTTGAAGGTAACGGAAGATCCACTTGACAGCGATCCAGTGCTCGACT
TGAGGGTTCTCCATGAATCGTGAAACATATCTGTTGCAGGTAATCCAATACGATCCCGCGATGATTACGGTAGGATGTTTACGCCACCGATGATAAGACG
AGTAGAATGATGGGACGAGTACAGAGTGTTGGTGATTGGATGCACCAAATGATTGGATGCAAACTAGGTAGAGAAGACAGTGTAAGTTCTTATCAATCAA
TCACTTCTGAATTTCCATTCTGCCCCTCAAGTGACTTCCCTCGCCTCGGCCTCCTCGCCCCAAGCTTCGGCAGTCCTCCCCTCGCAAGACGCAAGATCCA
ACCATCACCTTCTTCAGGTTCCGAAGCAGAAACGCACCAAGTTGGACGCTCGAGCAGTGAATTGTCGGTTTCTGGGGTACTCGGAACACGAGAAAGCGTA
TCGTTTCGAGGAGACCAAGAGCGGTCGTGTGCTAGTGAGCCGCGATGCGCAGTTCATGGAAGACGTCTTCGACGGAGGGAGACGCAGCCACGATGAAGAT
GACATCGTGGAGCTTCAACAAGAAGAAGTGACGGATCAAGAAGCATCGTCCGAGGATGAGACGATGGGAGACAATGCGCCGCGTCAAGAAGTTGAGCCCG
GCAGCAAGCGACACCAGCGAACGCAGTCGTTGGAGGAAGCGGAAGAGATCCCGCGAAGCAAGCGACAGAGTCGGCCGCAGACACTGGAAGAGATGTCAGC
GGTCGCAAGTAGTCGAGAAGAAGATTTCGAAGCGGCCTACGTTGTGGATTCAGTGGGAGAAATGCCGACTACGTTCAAGTCGGCGATGGAATCCAGCAGC
GCGGTCAAGTGGAAGGAGGCGTGCGACTCAGAAGTCGACTCTCTTCGCAATAACAAGACATGGTCGTTGGTGCCATTGTCCCAAGGTCGGAAGGCAATTG
GTTGTCGTTGGGTGTTTCGCATCAAGGAGAACCAAGCGGGAGCGTTTGAGCGGTTCAAGGCACGACTCGTGGCCAAGGGAGTTTCGCAGATGTACGGCAT
CGACTACGAAGAAACCTTCGCGCCAGTCGCCAAGTTCACGTCGATCAGGATCCTGCTCCGTCTGGCGGCTAAGTACAATCTGACGGTGCACCAGATGGAT
GTCGAGACGGCGTTCCTGAACGGGCTGCTTGATGAAGATATCTACATGGTGCAACCGGACGATTACACGGATGAAGAGCATCCTGACCATGTCTGCCATC
TCAAGCGCTCACTCTACGGTCTTAAGCAGTCGCCACGAATGTGGAACCAGACCATTGACAAGTTCATGCTGGAGCTGGGGATCAAGAAGTGTGAAGCCGA
TCTCTGCATCTACGTCAAGTGGGATGACCAAGACATGATCTTCGTGGCTCTCTACGTCGATGATCTGGTCCTCGCCAGTAACAACGACGAGCTGCTCAAG
TCGACGAAGAAGGCTTTGAGTGAACGATTCGACATGACGGACTTGGGTCGCCTCAAGTACTTCCTCGGTATGGAGATCGATCAAGATGTGACTTCAGATA
AGTGTCGGTGCGTCAGACCAAGTTTGTGAAGGACATCCTGGAGAAGTTTGGCATGGAGAACAGCAACCCTGTCAAGACCCCTCAAGACCTAGGACTCAAG
TTGACCAAGGCCATGTGCGAAGGAGGATGCAACCACGAAGAGACCATGGCCAAGGTGCCTTATCGCAATGCTGTCGGCTGCCTGATGTACCTCATGGTTG
GAACTCGGCCGGACCTCGCTGCTGCAGTGGGAGTTCTTAGCCAGTTCGCGGCGGACCCGTGTCCCACACACTGGCAAGCACTCAAGCGCGTCTTCCGCTA
CATTCAAGGTACGAAGACACACGGCATCGAGTTTCAACAAACAAGTGAAGAAGGACTCCAAGGCTACTCGGATGCGGATTGGGCTGGTGACGTCGAGACT
CGACGCAGTACAAGCGGCTACGCGTTCATGATGAACGGCGGATGCATTAGTTGGAGAAGCAAGAAGCAGCGCACGGTGGCGCTGTCATCGACGGAGGCGG
GGTACATGGCGTTGACGGAAGCTGCTCAATAAGCGATCTGGCTCAAGGCATTCCTGTGTGAACTCGGCGAAATGAAGAACGAGGATTCTGTCATGATTTT
CGAGGACAATCAAGGGTCGATAGCGCTGGCCAAGAACCCCGAGTTTCACAAGCGCACCAAGCACATCGACATTCGCTACCACTTCGTGCGCGAGAAGGTT
GAAGATGGCCAAGTGGTGTTGCAGTACTGCTCGACGAAGGACATGAAGGCGGATCTGATGACCAAGCCGATCACCGCGGTGCAGTTCGAATTTCTTCGCA
ACAAGCTGGGTATCAAGCCACCAAGCGCGGTCGAGTCGAGTGGGAGTGTTGTCAAGAAGGCGTCTCGTCCAGCTTCGGCATACCTGTAAACCCGGGTTCC
AAGGACCCCGCGATGTTTACGGTAAGTCAATTGCACAAACGGATGTATGCGCAAACAGATGATTGGACGAGTCCATGATTGGATGCACCAAATGATTGGA
TGCAGACTAGGACGTAAGACAGAGTAAGCTCCAAAAAATCAATCACTTTGCATTTTATCATCTAGTGCACAAACGACCTTCCTTTTAGTCCATCTACGAG
ATCCGCCGATGCCACCACTTGATTCGAGTCCTTGCGTGAGATGTGCATCTCGGTGCCATCGAACACCACCTGGAACTTTCCGTTCTTGTTGATCTGCGGT
ACTGAAAGCAGATTCTTGCTCATGTTAGGCACATAGAGCGCATTCTTGATCTCGATCTCGCGCTCGGCGCCGTTCGGCAGGACCACTCTTTCCACGATGG
TCCCCACACCCTTGATAGCCGCCTTGTTCCCGTCGGCCACCGAAAGTTCGCCTTCATTGCGCTCGATGAGATTGGCGAACTTGGACTTGTCGTTACAGAT
GTGGTGTGTGGCACCACTGTCGACCGCCCACATTCCAGACACATTCTTGTTCGTCGATACTCCACATTCCAGGGAAACTGTGGTGAAGTGCTTTCTCAGA
AATAAGAGAATGGTCCTGACGCGGGGTCACTATCCCGAATCAGTGACAATTTCAAGTGATTATAGAGGATTTGGGTTGTTTGGCACGGGTGCAAGTTGCC
TGTGGTGGATTAGCCATGGCGAGCAGCACCCCGTATGGAATGACGATGGATCTGATATGAGCGATGTACGAGAAGGCAAGATCCACCAAGACTTACCTCG
GATCCACCCTTACCTGGATTCACTAAGATGGATATGGGATATACTATACAAGAGTGGATCGAGTGTGGATCCTATGAAGGAAGGATGGTCGGTGCCCTCT
GACGGTGGATCTAGTAGCCACGGCTAATGAAGAGTCAAGATCCACCGCGAGGTACCCCGGATCCCATACTTCTGAGTTCGTATCCAAGGAGGGAGGATCC
CGCCTGGAGGGACCTGGATCCAGGGTATAGGGATGAGGGATACAGTGGATCTCGAACTTTCGTGGGACAACGGAGATCACAGACGGTTGCGAGATGATGT
TGGATGATTGGAGAGCTCGGATCCACGGCGAGTGTACAATTACAGTGAGGTGGATCCAAGCGACCTGGATCCGGATGAGTGTACCCATAATAGGGTGACC
ATGATGATTACGTCATGGATCCGGTGGATCTGAAGATAACACAGCTGGGATGATGGGTCAAGGGAAGAAGGGACATGCAGCCGAGCCTGGTAAGGGATTT
AGCAGATGAAAGACATAGAAGGTAGAAATCCAGGCAGGTATAGGCTTAAATATCAATACAGACTCCAATTTGCACAGTAACACGCAAGTGCCTTCCTGCC
CTCAAGAACCGGAACTACATTGGCCGTACGAGCTCCGAGAAGATTGGGAATTGCGAATCTAGTGTTGGTAGTGATAACTGGATAATACATTGGCCAGATC
CTACAACCTAGTGAGCTTTTCCTTTACTTGTGCAGATCCGACAGGTTAACCGAATTTACTACTTGGTCGGTTACACCCTAGGGGCTCTCAACTTTCAAGA
TCCCGTCACAGGAGGCGGCAAGTACGACGCAAAGGAACTACAAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGGCTAGATCCACGATCTAGGCCCC
GGATCCATAAGCTCGAATATTCGCTTAGGATACGGAACCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCATCCCCACGTCTCGCCA
AGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGAAAGTTCAGCAGAACA
CGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTGGCAATCTCGCAGATTTTGCTGATCCCGCTACACCACAA
TGGTGCGCGTGCCCGGATCTTTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGGAAGAGGCGTCGTCGGA
GGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAGAGAGGTGGATCCGGATCCG
GATCTAGAAGAGAAACCTCTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACGTAAAGTCAAGATCCGCTAACAAAACAAGGGAAAGTG
AAGGCGAAACGGTATGCATTTGCAGATTCGCCGATTAAGCCAACACCGTACCTAAACCCAAGCCCGCTAGTCGAAGAAACAAGAAAGAAGACGAAAACGA
GTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAAGCTGGTCCGACAAGGATCTCGAGTTTGTGTATCG
CCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCACGACAGATCGAAGATCCAAGGGAACCGGTGAGAGCACCAACG
AAAACGGCGAACAAGTTGGTGGCAGTCAAAGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAGAGGATATCTTCGAGC
TAGACCTGGATCTCATAGTATCCGCGACGCGGGACCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAAAGGTCGCGCACTATGGATCCAGTGTCGTCGCC
GAGGATCAGCCAAGCTGCGTCCTCAAACTACGAATCCGCCGCTGAGGATGAGTCAGACACGTCGTCCGAACCACGACGCATGACTTTAGGACCCTCCGGG
GCATCCATGCTGGAAGCGCGGGCGAGGATCCGAGGACAGGAAGCCCCTGTGAACGTGAAAGCTCGGGATCCAGTACGCCCTACGCGTGATTTGACACAA